ID: 1030253911

View in Genome Browser
Species Human (GRCh38)
Location 7:107484900-107484922
Sequence CAGACTGTGTAGAAAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 388}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030253908_1030253911 -9 Left 1030253908 7:107484886-107484908 CCTAAGAGGTCAATCAGACTGTG 0: 1
1: 0
2: 0
3: 14
4: 124
Right 1030253911 7:107484900-107484922 CAGACTGTGTAGAAAGAGGAGGG 0: 1
1: 0
2: 5
3: 34
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030253911 Original CRISPR CAGACTGTGTAGAAAGAGGA GGG Intronic
900841177 1:5049783-5049805 CAGACTGTGTAGAGGCGGGAAGG - Intergenic
900893177 1:5464408-5464430 CAGCCTCTGTAGAAAATGGATGG - Intergenic
900894869 1:5476322-5476344 CAGACTTTGGAGAAAGAGCTTGG - Intergenic
902110759 1:14076318-14076340 CACACTGTGAAGAGAGATGAAGG + Intergenic
903882002 1:26516913-26516935 AAGAGTGTTTAGAAAGAGGAGGG + Intergenic
904960923 1:34332167-34332189 CAAGCTGTTTAGAAAGGGGATGG + Intergenic
906977061 1:50587148-50587170 CAGGATTTGGAGAAAGAGGATGG - Intronic
907060463 1:51417832-51417854 CAGACAGTCAAAAAAGAGGAGGG + Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907503251 1:54899199-54899221 CAGACTGTATAGAGGTAGGAAGG + Intergenic
908126152 1:61032022-61032044 CAGAATATGTAGAAAAGGGACGG + Intronic
908888146 1:68813693-68813715 CTGACTTTGAAGAAGGAGGAAGG + Intergenic
909550715 1:76896121-76896143 CAGACTGTATAGACATGGGAAGG + Intronic
910076302 1:83283061-83283083 AAGGCTGTGGAGAAATAGGAAGG - Intergenic
911400776 1:97372251-97372273 CAGACTGTGAAACAAGTGGAGGG + Intronic
912864533 1:113245602-113245624 CAGAATGTGGAGAAAGAGAGAGG - Intergenic
913375504 1:118147215-118147237 CAGACGATGAAGAGAGAGGAAGG - Intronic
914998646 1:152566501-152566523 CTGCCTGAGTAGAAAGAGGATGG + Intronic
914999998 1:152580230-152580252 CAGCCTGAGTAGAAAGAGGATGG + Intronic
915424609 1:155814487-155814509 CAGACTTTGTGGAATGAGGTAGG - Intronic
915824779 1:159063868-159063890 TAGACTGAGGAGGAAGAGGAGGG - Intronic
916216333 1:162398114-162398136 CAGACAGAGTAGAATGGGGATGG + Intronic
917608723 1:176664368-176664390 CAGGCTTTGAAGAAGGAGGAAGG - Intronic
917646212 1:177031336-177031358 CAGACTGTGATGAAAGAGAAGGG - Intronic
918124463 1:181570669-181570691 CTGACTCTGAAGATAGAGGAAGG - Intronic
919476789 1:198039664-198039686 CAGACTGTATAGAGGTAGGAAGG - Intergenic
920306730 1:205023180-205023202 CAAGCGGTGCAGAAAGAGGAGGG - Intergenic
920447858 1:206033484-206033506 CTGACTGTGAAGACAGAGGAAGG - Intergenic
920601433 1:207328930-207328952 CATACAGTGTGGGAAGAGGAAGG - Intronic
922048722 1:221970317-221970339 CAGACTGTGTAGAGGTGGGAAGG - Intergenic
922777554 1:228223095-228223117 CATATTGTTTAGAAATAGGAAGG + Intronic
923861432 1:237895757-237895779 CACATTGAGTAGGAAGAGGAGGG + Intergenic
924256910 1:242191842-242191864 CAGACTGGGGCGAAATAGGAGGG + Intronic
1063295487 10:4800897-4800919 CAGGCTGTGCAGGAGGAGGATGG - Intronic
1063768692 10:9172750-9172772 AAGACTTTGTAGACAGAGTAGGG - Intergenic
1064434059 10:15295414-15295436 CAGACTGTGCAGAAAGCAGGTGG - Intronic
1065330696 10:24595345-24595367 CAGGCTGTGTAAATATAGGATGG - Intronic
1065438041 10:25721598-25721620 CAGACTGTATAGAAGTGGGAAGG - Intergenic
1068331450 10:55576358-55576380 CAGGCTGAGGAGAAAGAGGAAGG + Intronic
1069168740 10:65198190-65198212 CAGTCTGGGTAGATAGAGCAGGG + Intergenic
1069774179 10:70917291-70917313 GAGACTGAGGAGGAAGAGGAGGG - Intergenic
1071051386 10:81453396-81453418 CAGACTTTATAGAAATAGAAAGG - Intergenic
1072729287 10:97834352-97834374 CAGACTCTATAGGAAGAGGAAGG - Intergenic
1073395125 10:103211203-103211225 CAGACTGTATAGAGGTAGGAAGG - Intergenic
1074423793 10:113333060-113333082 GAGACAGTGTATAAAGAGGTAGG - Intergenic
1075976621 10:126701680-126701702 GCCACAGTGTAGAAAGAGGAGGG - Intergenic
1077766067 11:5161607-5161629 CAGACTGTATAGAGGTAGGAAGG + Intronic
1078184645 11:9041384-9041406 GAGAGTGTGAAGACAGAGGAAGG + Intronic
1078523134 11:12079381-12079403 GAGGCTGTGGAGAAATAGGAAGG - Intergenic
1079105963 11:17572558-17572580 CTGACTGTGTAGAAAGAACAAGG - Intronic
1079479636 11:20865745-20865767 CACAGTGTGTAAAAAGAAGATGG - Intronic
1079711269 11:23685331-23685353 CACACAGTGTAGAAAGTCGATGG - Intergenic
1080347459 11:31340882-31340904 CAGAATGAGTAGATAGAGAAGGG + Intronic
1080388576 11:31824829-31824851 CAGACTGGGCAAAAAGAGTAGGG - Intronic
1081297813 11:41413116-41413138 CAGAATGTAGAGAATGAGGATGG + Intronic
1081979710 11:47258547-47258569 CAGACTTTGGAGTCAGAGGAGGG + Exonic
1082737708 11:56874705-56874727 GATACTGTGTAGAAAGTAGATGG - Intergenic
1084031665 11:66484825-66484847 CAGGCTCTGGAGAAAGAGGGAGG + Intronic
1084958973 11:72706273-72706295 CAGTCTGGGTAGAAAGATGAAGG - Intronic
1085300161 11:75453170-75453192 CAGACTGGGGAGGAGGAGGAAGG + Intronic
1085660547 11:78361736-78361758 AAGACTGTGGAAAAAGAGGCAGG + Intronic
1085728687 11:78977716-78977738 GAGGATGTGGAGAAAGAGGAAGG + Intronic
1085802033 11:79599631-79599653 CAGACATTGTAGAAAGACTAGGG - Intergenic
1086557661 11:88130492-88130514 CAGACTGTGGACACAGAGAATGG + Intronic
1086683654 11:89705507-89705529 CAAACTATGCAGAAAGATGAGGG + Intergenic
1087376615 11:97350746-97350768 AAGATTGTGGAGAAAAAGGAAGG + Intergenic
1087600636 11:100310667-100310689 CAGACTATGTAGAAAAAATAGGG + Intronic
1088497538 11:110446657-110446679 CAGGTTGGGAAGAAAGAGGAAGG - Intronic
1088728685 11:112661653-112661675 CAGACAGTGGAAAAAGAAGAGGG - Intergenic
1088729277 11:112666590-112666612 GAGGCTGTGTCGAAAGAGAATGG - Intergenic
1088857962 11:113773374-113773396 CAGAATGTGTGGATTGAGGAGGG - Intronic
1091305492 11:134533279-134533301 CCCACTGTGTAGGAAGAGAATGG - Intergenic
1091440773 12:510603-510625 CGGTCTGGGTACAAAGAGGAGGG + Intronic
1091607470 12:1967154-1967176 CTGATTGCGTTGAAAGAGGAGGG - Intronic
1092009033 12:5094220-5094242 CACACTGTTTAAAAAGTGGAGGG - Intergenic
1093105885 12:15086583-15086605 CTGACTTTGAAGAAGGAGGAAGG - Intergenic
1093593791 12:20938525-20938547 CAAACTGTATAGCAAGAGTAGGG - Intergenic
1094826179 12:34270867-34270889 CAGACTGTATAGAGAAGGGAAGG - Intergenic
1095867435 12:46988005-46988027 GAGGCTGTGGAGAAATAGGAAGG + Intergenic
1096469886 12:51869320-51869342 CAGGCTGTGGGGGAAGAGGAGGG + Intergenic
1096675592 12:53223990-53224012 CAGAGTGTGATGAAAGAGAAGGG - Intronic
1097947648 12:65389626-65389648 CAGACTGGGAAGAAAGGGAAGGG - Intronic
1098016813 12:66113913-66113935 GAGCCTGTGTACAAAGAGGTGGG + Intergenic
1099211816 12:79800302-79800324 CACACTGAGGAGGAAGAGGAGGG - Intronic
1099910484 12:88826788-88826810 CAGATTATGTGGAAAGAGGTTGG + Intergenic
1100090132 12:90958170-90958192 CAGAATGTGAAGCAAGAGAAAGG - Intergenic
1101023992 12:100582894-100582916 CAGGCTGTGAAGACGGAGGAGGG - Intronic
1101197911 12:102404510-102404532 CTGACTGAGTAGAAGGAAGATGG + Intronic
1101214202 12:102564290-102564312 ACAGCTGTGTAGAAAGAGGATGG - Intergenic
1101299526 12:103464203-103464225 GAGGCTGTGGAGAAATAGGAAGG - Intronic
1101395010 12:104339070-104339092 TAAGCTGTGTAGGAAGAGGAGGG + Intronic
1101557066 12:105820323-105820345 CATCCTGTGTACAGAGAGGAAGG + Intergenic
1101667328 12:106831182-106831204 CAGCCTGTGGAGAAAGAAGGTGG - Intronic
1101718836 12:107333923-107333945 GACATTGTGTAGAAAGATGAAGG + Intronic
1102637290 12:114335593-114335615 CAGGCTGGGAAGGAAGAGGAGGG + Intergenic
1103091023 12:118098170-118098192 CAGAAGGGGTAGAAAGAAGAGGG + Intronic
1104573000 12:129941844-129941866 GAAACTTTGCAGAAAGAGGAAGG - Intergenic
1105432745 13:20352064-20352086 CAGAGTGTGAGGAAAGAGCAGGG - Intergenic
1105505842 13:21009044-21009066 AAGACTGTGAAGAAAGAGCATGG - Intronic
1106597631 13:31160853-31160875 GAGACTGGGTAAAAAGAGGTGGG + Intronic
1107041584 13:35954267-35954289 CGAATTGTGCAGAAAGAGGAAGG - Intronic
1107609794 13:42101876-42101898 AAGAGTGTGTAGGAAGAGGTAGG + Intronic
1108223656 13:48265322-48265344 CACACTGTTTGGAAAGAAGAAGG - Exonic
1108850999 13:54728800-54728822 CAGAATGTGGAGGAAGAGCAAGG - Intergenic
1109839190 13:67900952-67900974 GAGAATGTGGAGAAATAGGAAGG + Intergenic
1110347089 13:74461165-74461187 GATACTGTGAAGAAAGAGAAAGG - Intergenic
1110347091 13:74461237-74461259 GATACTGTGAAGAAAGAGAAAGG - Intergenic
1111364596 13:87225184-87225206 TAGGCTGTGGAGAAATAGGAAGG - Intergenic
1112002909 13:95228380-95228402 CAGACTGAGTAGGAAGTGGAAGG - Intronic
1112247836 13:97750552-97750574 CAGAGAGGGGAGAAAGAGGAGGG - Intergenic
1112399681 13:99065142-99065164 CTCACTGTGTGGAGAGAGGAAGG + Intronic
1113110771 13:106821156-106821178 CAGAATGTGAAGAAAAAGGGGGG - Intergenic
1114478051 14:23011451-23011473 CAGTCTGTGCTGAAAGAGAATGG - Intergenic
1114690735 14:24577604-24577626 CAGACAGTGGGGTAAGAGGAGGG - Intergenic
1115995573 14:39192444-39192466 CAGTGTGTGTAGGAAGAGGGAGG + Intergenic
1116605505 14:46988299-46988321 CAGACTGGATAGAAACAAGAAGG + Intronic
1117762149 14:59040514-59040536 CAGACTGGGAAGAAAGATGAAGG + Intergenic
1118347907 14:64953041-64953063 CAGACTGTGGAGAGAGAGGAGGG + Intronic
1118857732 14:69637169-69637191 CAGACAGAGCAGAAAGAGGTGGG - Intronic
1119147427 14:72329888-72329910 GAGACTGTGTAGCCAGAGGTGGG - Intronic
1120156934 14:81103756-81103778 CAGATTGCGTGGAAAGAGGATGG - Intronic
1120337878 14:83181234-83181256 CAGACTATGTGGAAACAGGGTGG + Intergenic
1120480365 14:85041740-85041762 CAGCCTGTGTTCAAAGAGGGAGG - Intergenic
1120567869 14:86081844-86081866 CAGACTCTGATGATAGAGGAGGG - Intergenic
1120913447 14:89688945-89688967 CAGATTGTATGGAAAGAGGGAGG - Intergenic
1121460871 14:94076925-94076947 TAGGCTGAGTAGAAAGAGGAGGG - Intronic
1121888941 14:97571516-97571538 CAGAATGTGTATATTGAGGAGGG - Intergenic
1121926837 14:97934712-97934734 CTGACTTTGAAGAAAGAGGAAGG + Intronic
1122680148 14:103454036-103454058 CAGGTTTAGTAGAAAGAGGATGG + Intronic
1122916578 14:104861882-104861904 CAGACGGTGGAGATAGAGGGTGG - Intergenic
1202842375 14_GL000009v2_random:133789-133811 GAGAGTGTGGAGAAATAGGAAGG - Intergenic
1202911760 14_GL000194v1_random:124030-124052 GAGAGTGTGGAGAAATAGGAAGG - Intergenic
1123728571 15:23126853-23126875 CCGACTGTGGAGAAAGGGGGCGG - Intergenic
1123740263 15:23278240-23278262 CCGACTGTGGAGAAAGGGGGCGG + Intergenic
1123746735 15:23324318-23324340 CCGACTGTGGAGAAAGGGGGCGG - Intergenic
1124279002 15:28347634-28347656 CCGACTGTGGAGAAAGGGGGCGG - Intergenic
1124303696 15:28563974-28563996 CCGACTGTGGAGAAAGGGGGCGG + Intergenic
1124532595 15:30520451-30520473 CCGACTGTGGAGAAAGGGGGCGG + Intergenic
1124592442 15:31065268-31065290 CAGAGTGGGTAGAATGGGGATGG - Intronic
1124766058 15:32487193-32487215 CCGACTGTGGAGAAAGGGGGCGG - Intergenic
1125450192 15:39799845-39799867 CAGACTGGGTAGAAGAGGGAGGG - Intronic
1125600640 15:40913777-40913799 CCCACTGTGTAGATAGAGGAAGG + Intergenic
1127034507 15:54900517-54900539 GAGTCTGTGGAGAAATAGGAAGG + Intergenic
1127612939 15:60654784-60654806 CTGACTTTGGAGACAGAGGAAGG + Intronic
1128675218 15:69603409-69603431 TGGAGTGTGGAGAAAGAGGAGGG + Intergenic
1129259807 15:74358757-74358779 CAGACTGTATAGAGGTAGGAAGG - Intronic
1130848792 15:87773389-87773411 GAGGCTGTGGAGAAATAGGAAGG + Intergenic
1131233079 15:90673631-90673653 AAGACTCTGAAGAAAGAGGGAGG - Intergenic
1131827307 15:96331753-96331775 CAGAACGTGGAGAAAGAGGGAGG - Exonic
1133493019 16:6289880-6289902 GAAGCAGTGTAGAAAGAGGAGGG + Intronic
1134377864 16:13695169-13695191 CAGACTAAGGAAAAAGAGGAGGG + Intergenic
1135300133 16:21319659-21319681 CAGGCTGGGGAGACAGAGGATGG - Intergenic
1135347925 16:21705150-21705172 CAGCCTGTGTGAGAAGAGGAGGG - Exonic
1137363859 16:47843709-47843731 CAGACTGTATAGAGGTAGGAAGG - Intergenic
1138512578 16:57517094-57517116 CAGGCTGTGTGGGCAGAGGATGG - Intronic
1139506117 16:67398926-67398948 AACACTGTGTAGAAAGAGCCTGG + Exonic
1139943401 16:70622132-70622154 CAGACTGTATAGAGGGGGGAAGG + Intronic
1141659792 16:85435671-85435693 GAGACGGTGTAGGATGAGGATGG + Intergenic
1144121515 17:12158537-12158559 CTGGCTGTGGAGAAAGGGGAAGG - Intergenic
1145763168 17:27439363-27439385 GAGACAGTGTAGACAGAGAAGGG - Intergenic
1145995729 17:29103747-29103769 CAGACTGTCTAGGAGGAGGGAGG - Intronic
1146373640 17:32280477-32280499 CAGGCTGTGAAGGAGGAGGAAGG + Intronic
1146598221 17:34187657-34187679 CAGACTGTATAGAGATGGGAAGG - Intergenic
1146724112 17:35143620-35143642 GAGAATGGGTAGAAAGAGGCAGG - Intergenic
1147652176 17:42068951-42068973 CACCCTGGGTAGAAAGAGGTGGG + Intergenic
1147907360 17:43832034-43832056 CAGGCTGTGGACAGAGAGGATGG + Intronic
1148208127 17:45792270-45792292 CAGAGTTGGCAGAAAGAGGAAGG - Intronic
1149120341 17:53155881-53155903 CAGGCTGTGGAGAAAAGGGAAGG - Intergenic
1149173950 17:53846771-53846793 CTGGCTTTGAAGAAAGAGGAAGG - Intergenic
1151535986 17:74738950-74738972 CATAGTGGGTAGAAGGAGGAGGG - Intronic
1152307170 17:79527925-79527947 CTGACTCGGCAGAAAGAGGAAGG - Intergenic
1152515414 17:80820704-80820726 CAGACTGGGGAGAAGGAGGAGGG + Intronic
1156101080 18:33595636-33595658 CATACTCTGCAGAGAGAGGATGG - Intronic
1156225813 18:35106024-35106046 CAGACTGTGTATAAAGAGAACGG - Intronic
1156690235 18:39698545-39698567 TAGAGTGTTTAAAAAGAGGATGG - Intergenic
1157915134 18:51656960-51656982 CATGCTGTGGAGAAAGAGCAGGG + Intergenic
1158190077 18:54817714-54817736 CTGACTGTGTAGAAGGTGGATGG - Intronic
1158576412 18:58642488-58642510 CAGACTGTATAGAGGTAGGAAGG + Intergenic
1158726184 18:59974979-59975001 CAGAGTCAGTAGAAAGAGAAAGG + Intergenic
1159773631 18:72578543-72578565 CATACTTAGTAGAAAAAGGAGGG - Intronic
1160238483 18:77104828-77104850 CAGAATGTGGACCAAGAGGAAGG + Intronic
1161509636 19:4663297-4663319 GAGGCTGTGTAGAATGAGGATGG - Intronic
1161509654 19:4663384-4663406 GAGGCTGTGTAGAATGAGGATGG - Intronic
1161509665 19:4663431-4663453 GAGGCTGTGTAGAATGAGGATGG - Intronic
1161509686 19:4663517-4663539 GAGGCTGTGTAGAATGAGGATGG - Intronic
1161509698 19:4663562-4663584 GAGGCTGTGTAGAATGAGGGTGG - Intronic
1161509743 19:4663736-4663758 GAGGCTTTGTAGAATGAGGATGG - Intronic
1161509756 19:4663781-4663803 GAGGCTGTGTAGAATGAGGATGG - Intronic
1161509768 19:4663828-4663850 AAGCCTGTGCAGAATGAGGATGG - Intronic
1163350316 19:16772816-16772838 CAGAGTGTGATAAAAGAGGAAGG + Intronic
1163451752 19:17381827-17381849 AATACTGTGCAAAAAGAGGAAGG - Intergenic
1163575922 19:18110633-18110655 CAGACTGCAAAGAAAGAGGCCGG - Intronic
1163594875 19:18215225-18215247 CAGGGTGTGCAGAATGAGGAAGG - Intronic
1165209139 19:34218763-34218785 GAGAATGTGTAGATACAGGAAGG + Intronic
1165412452 19:35670420-35670442 CTGCCTGTGTAGAAAAACGAAGG - Intronic
1167248479 19:48388672-48388694 GAGACTTTGTCGAAAGAGAAAGG + Intronic
1167695713 19:51014706-51014728 CCGACTGGGGAGGAAGAGGATGG + Exonic
1168148155 19:54430796-54430818 CAGCCTCTGCAGAAAGAGAAAGG - Exonic
1202656463 1_KI270708v1_random:27707-27729 GAGAGTGTGGAGAAATAGGAAGG + Intergenic
925363443 2:3295356-3295378 GAGGGTGTGTAGAGAGAGGATGG - Intronic
925363463 2:3295455-3295477 GAGGGTGTGTAGAGAGAGGATGG - Intronic
925363575 2:3295995-3296017 GAGGGTGTGTAGAGAGAGGATGG - Intronic
926700328 2:15799246-15799268 CAGACATTCTAGACAGAGGAGGG + Intergenic
927133696 2:20081309-20081331 GAAACTCTGTAGAAATAGGAGGG + Intergenic
927788622 2:25992191-25992213 CAGGTAGTGTTGAAAGAGGAAGG - Intergenic
927972311 2:27313378-27313400 CAGAAAGTATAGAGAGAGGAAGG + Intronic
929547031 2:42862575-42862597 CAGGCTTTGTGGAAAGAGCAGGG + Intergenic
929658185 2:43755208-43755230 CAGAATGTGAACACAGAGGAGGG - Intronic
930307382 2:49692481-49692503 GAGGCTGTGGAGAAATAGGAAGG - Intergenic
931622046 2:64220365-64220387 CAGATGGTGTAGAAAGATGATGG + Intergenic
934159197 2:89232067-89232089 GAGACTGTGAGGAAGGAGGAGGG + Intergenic
934208076 2:89950358-89950380 GAGACTGTGAGGAAGGAGGAAGG - Intergenic
935211595 2:100943637-100943659 CAGGCTGTGCAGTAAGAAGAGGG + Intronic
936285101 2:111175631-111175653 CAGGCTTTGGAGGAAGAGGAGGG + Intergenic
937927613 2:127179228-127179250 CAGACTCTGGAGATGGAGGAAGG - Intergenic
938041631 2:128080959-128080981 CAGACTGTCTCTGAAGAGGAGGG - Intergenic
938665682 2:133533452-133533474 CAAACTTTAGAGAAAGAGGAAGG - Intronic
939174433 2:138733136-138733158 TAGACTGTGTAGATATGGGATGG - Intronic
939375170 2:141355980-141356002 CAGGCTGTGTAGACTGAGGAAGG - Intronic
940135526 2:150431723-150431745 CAGACTGTGCAGAAAGGGAGGGG - Intergenic
943070433 2:183134991-183135013 CTGACTGTGAAGATGGAGGAAGG - Intronic
943686228 2:190821222-190821244 CAGACTGAAATGAAAGAGGAAGG - Intergenic
944829197 2:203515315-203515337 TATACTGTGTAAAAAGAGAAGGG + Intronic
945157878 2:206858650-206858672 CAGACTGTGTGGAGAGAGGATGG + Intergenic
945363152 2:208916771-208916793 CATCTTGTGTAGAATGAGGAAGG - Intergenic
946070610 2:217031298-217031320 CAGACTGTCTGGAAAGATGCTGG + Intergenic
946932370 2:224683493-224683515 CTGACTTTGAAGATAGAGGAAGG + Intergenic
947225435 2:227835427-227835449 CATACCATATAGAAAGAGGAAGG - Intergenic
1169748175 20:8964165-8964187 CAGCCTGTGTGGAATAAGGAAGG + Intronic
1171266996 20:23779610-23779632 GAGGCTGTGGAGAAATAGGAAGG - Intergenic
1171276716 20:23862385-23862407 GAGGCTGTGGAGAAATAGGAAGG - Intergenic
1172999252 20:39093650-39093672 CAAAATGTGGAGAAAGAAGAGGG + Intergenic
1173526389 20:43736118-43736140 AAGGCTGTGGAGAAAGAGTAAGG + Intergenic
1173590563 20:44221616-44221638 AAGACTGTGTGGAAAGGGGTGGG + Intergenic
1174103103 20:48142205-48142227 CAGACTGTGTATGAGGAGGGAGG - Intergenic
1174106400 20:48165397-48165419 CAGACTGAGTACACAGAGGGAGG + Intergenic
1174522772 20:51144548-51144570 CGGACTTTGAAGGAAGAGGATGG + Intergenic
1174991713 20:55518090-55518112 GAGGCTGTGGAGAAATAGGAAGG - Intergenic
1175802247 20:61807475-61807497 GAGATGGAGTAGAAAGAGGAGGG - Intronic
1176631122 21:9138697-9138719 GAGAGTGTGGAGAAATAGGAAGG - Intergenic
1178956448 21:37026668-37026690 CAGACTGTGGAGAGTGGGGAAGG - Intergenic
1179096094 21:38315608-38315630 CATACTTTGTAAAAAGAGAATGG + Intergenic
1179730779 21:43366136-43366158 TAAACTGTGGAGACAGAGGAAGG + Intergenic
1182454011 22:30438357-30438379 CAGCCAGGGTAGAGAGAGGAGGG - Intergenic
1182848305 22:33449854-33449876 CAGACTGTTTATAAACATGAGGG - Intronic
1182998925 22:34838693-34838715 CAGACTGTATAGAGGTAGGAAGG - Intergenic
1183023058 22:35042948-35042970 CAGACTGAAGAGAAAGAAGAAGG + Intergenic
1184895222 22:47402783-47402805 GTGACTGTGGAGAGAGAGGAAGG + Intergenic
949372054 3:3346065-3346087 TAGACTGTGGAGAATGAGAAAGG + Intergenic
949441086 3:4081322-4081344 CAGGCAGTGAAGAAAGAGGATGG - Intronic
949591704 3:5500968-5500990 CAGACTTTCTTGTAAGAGGATGG + Intergenic
950822484 3:15775900-15775922 CAGTCTCTGGAGAAAGAAGAGGG - Intronic
951265617 3:20562490-20562512 TCGACTGTGAAGAAAGAGTATGG - Intergenic
951526005 3:23653617-23653639 CAAGATGTGTAGAAAGAAGAGGG + Intergenic
951554432 3:23906537-23906559 TAGACTGAGGAGAAGGAGGAGGG - Intronic
953431228 3:42842160-42842182 CAAACTGTGCAGAGACAGGATGG + Intronic
953702477 3:45207481-45207503 CAGACTTTGCAGAGAGAGAAAGG + Intergenic
953925055 3:46978546-46978568 CAGACTGTGAGGTAAGGGGATGG + Intronic
954047397 3:47944350-47944372 CAGACTGTGGAGAATGAGAAAGG - Intronic
954169315 3:48787941-48787963 CAGAATGTGCAGAGACAGGAAGG - Intronic
954285850 3:49618389-49618411 TAGTCTGTGTGGCAAGAGGAAGG - Intronic
956554264 3:70500323-70500345 CAGACTGTCTAGAAACTGAAAGG + Intergenic
957170704 3:76733244-76733266 CAGACTGTGTATACAAAGAAGGG + Intronic
957617599 3:82551330-82551352 CAGACTTGGAAGATAGAGGAAGG - Intergenic
958183187 3:90085441-90085463 CAGACTGTGTAGAGGTGGGAAGG - Intergenic
959588714 3:108052308-108052330 CACTCTGGGTAGATAGAGGAGGG - Intronic
961458278 3:127034838-127034860 CAGCCTGTGTAGGACGCGGAGGG - Exonic
961540156 3:127593939-127593961 CAGACTGTGATGACAAAGGATGG - Intronic
961910117 3:130305864-130305886 CTGACTGTGAAAACAGAGGAGGG - Intergenic
963472283 3:145755250-145755272 CAGACTGGATAGAAAAAGGTTGG - Intergenic
963730717 3:148968600-148968622 TACACTGTGTAGAAACAGCAAGG - Intergenic
964128883 3:153265841-153265863 GAGGCTGTGGAGAAATAGGAAGG + Intergenic
964753611 3:160074837-160074859 GAGACTGTGCAGAAAGGAGATGG - Intergenic
965480386 3:169211688-169211710 AAGACAGTGCAGAAAGAGAAAGG - Intronic
965888378 3:173477915-173477937 CAGGTTGTGGAGAAATAGGAAGG + Intronic
967643501 3:191896675-191896697 CAGACTGTATAGAGGTAGGAAGG + Intergenic
967726586 3:192868017-192868039 CAGACAGGGTACAAAGCGGATGG - Intronic
967985833 3:195094767-195094789 CAGGCTGTGTGGAGAGGGGAAGG - Intronic
968692726 4:2003240-2003262 GAGGCTGTGGAGAAATAGGAAGG + Intronic
968939729 4:3631537-3631559 CAGGCTGTGTAGACAGGGCAGGG - Intergenic
970063079 4:12057705-12057727 CAGACTTTGCAGAAAGGGTATGG + Intergenic
970827413 4:20293045-20293067 AAGTCTGTATAGAAAGAGGGGGG + Intronic
971642707 4:29156449-29156471 CTGATTGAATAGAAAGAGGATGG + Intergenic
972312937 4:37898401-37898423 CAAGGTGTGTAGAAACAGGAAGG - Intronic
972350955 4:38235880-38235902 CATACTGAGTAGACGGAGGAGGG + Intergenic
974904220 4:68035904-68035926 CAGACTGTATAGAGGTAGGAAGG - Intergenic
975515158 4:75239357-75239379 TGGTCTCTGTAGAAAGAGGAGGG - Intergenic
975634973 4:76439188-76439210 CAGACTTTGAAGATGGAGGAAGG - Intronic
975660340 4:76682202-76682224 CTGACTGGGAAGAAAGATGAAGG + Intronic
976720835 4:88167309-88167331 CAAACTGTTTTGAAAGTGGAGGG - Intronic
977574754 4:98663891-98663913 CATCCTCTGCAGAAAGAGGAAGG + Intergenic
977815850 4:101413099-101413121 GAGGCTGTGGAGAAATAGGAAGG + Intronic
978134465 4:105240549-105240571 CACACTGTGTAGAAGGATGGAGG + Intronic
978400514 4:108325637-108325659 CAGTTTGTGTGGAAAGAGAATGG + Intergenic
979344559 4:119571458-119571480 CAGATTTTGAAGACAGAGGAAGG + Intronic
979894854 4:126146468-126146490 CAGACTGTGTAGAGGTGGGAAGG + Intergenic
980713383 4:136599986-136600008 AAGAATGTGTAGAAAAGGGAAGG + Intergenic
981000975 4:139828960-139828982 AAGACCCTGTTGAAAGAGGAAGG + Intronic
983543876 4:168941695-168941717 GCGACTGTGGAGAAATAGGAAGG - Intronic
983805475 4:171987365-171987387 CAGACTGTATAGAGATGGGAAGG + Intronic
983987629 4:174079403-174079425 AGGACTGTGTAGAAAGAGGAAGG - Intergenic
989138894 5:38182529-38182551 CAGACTTAGTAGAAAGAGCATGG + Intergenic
992595225 5:78339925-78339947 CAGACTCAGGAAAAAGAGGAAGG - Intergenic
993693260 5:91028642-91028664 CAGATTGTGTTTAAAGAGGCTGG - Intronic
994176315 5:96715351-96715373 CAAAATGTGTAGATAGAGGCTGG - Intronic
994557231 5:101319283-101319305 CAGACTGTGTAGAGGTGGGAAGG - Intergenic
995028465 5:107451736-107451758 GAGGCTGTGGAGAAACAGGAAGG + Intronic
996109835 5:119552312-119552334 GAGGCTGTGGAGAAATAGGAAGG - Intronic
998178616 5:139918826-139918848 GAGAAAGTGTAGACAGAGGAAGG + Intronic
998238372 5:140420000-140420022 GAGACTGTGTGGAGAGGGGAGGG - Intronic
999257049 5:150215594-150215616 CAGCCTGGGGAGAAAGAGGCTGG + Intronic
999424111 5:151471990-151472012 CAGACTGTGTGGAAGGGGCAGGG - Intronic
999474031 5:151881665-151881687 GAGTCTGTGCAGCAAGAGGAAGG - Intronic
999970779 5:156860102-156860124 CAGACTGAGTGGAAAGCAGATGG + Intergenic
1000734781 5:164885695-164885717 TAGAGGGTGGAGAAAGAGGAGGG + Intergenic
1004448375 6:15723657-15723679 CAGACTGCTTAGACAGAGGGAGG + Intergenic
1005075211 6:21900087-21900109 AAGACTCTTTAGAAAGAGAAGGG + Intergenic
1005080886 6:21955320-21955342 CAGTATGTGAAGGAAGAGGAAGG + Intergenic
1007662751 6:43496579-43496601 CAGGCTGTCCAGACAGAGGAGGG + Intronic
1007937029 6:45741584-45741606 CAGAGTGGGCAGAAACAGGAGGG - Intergenic
1008089475 6:47279006-47279028 CAGACTGTGAAGAAAAGTGAGGG - Intronic
1008413065 6:51205848-51205870 GGGGGTGTGTAGAAAGAGGAAGG + Intergenic
1008675291 6:53812392-53812414 CAGAATTTGAAGAAAGAGGCCGG + Intronic
1009213759 6:60894482-60894504 CAGCCTGTGGAAAGAGAGGAAGG - Intergenic
1011969903 6:93210171-93210193 CAGAGTGTGAAGAAAGTGGCAGG + Intergenic
1012512201 6:100014831-100014853 CAGGCTGGAGAGAAAGAGGAGGG + Intergenic
1013260334 6:108435224-108435246 CAGGCTTTGTAGTAAGATGAAGG + Intronic
1014260149 6:119207188-119207210 ATGAATGTGTACAAAGAGGAAGG - Intronic
1016487843 6:144562832-144562854 GAGGCTGTGGAGAAATAGGAAGG - Intronic
1017159109 6:151348986-151349008 CTCACTGTGAAGAAAGATGAAGG + Exonic
1017573445 6:155773809-155773831 GAGGCTGTGGAGAAATAGGAAGG - Intergenic
1017779025 6:157701989-157702011 CAGACTGTGTAGAGGTGGGAAGG + Intronic
1018053254 6:160030053-160030075 CAGACTGGGAAGAGAGAGGGAGG - Intronic
1018962351 6:168457814-168457836 TAGACTCATTAGAAAGAGGAGGG - Intronic
1019932269 7:4231542-4231564 CAGCCTGTGTGGACAGAGGAGGG + Intronic
1020390909 7:7656944-7656966 GAGGATGTGTAGAAATAGGAAGG - Intronic
1020525739 7:9256357-9256379 GAGGCTGTGGAGAAATAGGAAGG + Intergenic
1020636735 7:10705001-10705023 CAGAGTATGTAGGGAGAGGAAGG - Intergenic
1020993746 7:15235066-15235088 CAGAATCTATAGAAAGAAGAGGG - Intronic
1021785865 7:24152079-24152101 CAGACTGGGGAGAAGGAGAAGGG - Intergenic
1022421061 7:30223849-30223871 CAGTATGTGTAGAATGAGAAAGG + Intergenic
1023706977 7:42951256-42951278 AAGACCCTGTAGCAAGAGGATGG + Intergenic
1023794879 7:43783366-43783388 CAGTCTGTGTAGTAACAGGAGGG - Intronic
1023981248 7:45071731-45071753 CTGGCTGTGAAGACAGAGGAAGG - Intronic
1024045733 7:45584431-45584453 CCCACTGTGGACAAAGAGGATGG + Intronic
1024441698 7:49426998-49427020 GCGACTGTGAATAAAGAGGATGG + Intergenic
1024868545 7:53933667-53933689 GAGGCTGTGGAGAAAAAGGAAGG + Intergenic
1025003672 7:55339161-55339183 CAGAAGGAGTAGAATGAGGAAGG + Intergenic
1027294075 7:76748354-76748376 AAGGCTGTGGAGAAATAGGAAGG - Intergenic
1028249357 7:88522781-88522803 CAGGCTGTGGAGAAGGAGCAGGG + Intergenic
1028387399 7:90272694-90272716 AAGACAATGTAGAGAGAGGAGGG - Intronic
1028527661 7:91803210-91803232 CTGACTTTGAAGACAGAGGAAGG - Intronic
1029944198 7:104514520-104514542 CAGTCTGTTTAGAAACATGATGG + Intronic
1030253911 7:107484900-107484922 CAGACTGTGTAGAAAGAGGAGGG + Intronic
1030876999 7:114825968-114825990 CATACAGGGTTGAAAGAGGAGGG + Intergenic
1031877172 7:127154860-127154882 CAAACTGTCTAGAAACAAGAAGG + Intronic
1032156756 7:129475955-129475977 GTGTCTGTGTAGAAAGAGGCGGG - Intronic
1032554126 7:132813779-132813801 CAGGTGGTGGAGAAAGAGGAGGG + Intronic
1032945483 7:136847269-136847291 CTTACTGGGTAGCAAGAGGAGGG - Intergenic
1033463301 7:141567153-141567175 CAGAGTGTGTAGAATGAGAATGG - Intronic
1033574915 7:142671615-142671637 CAGCCTGTGTAGAAAGTCAAAGG - Intergenic
1033609300 7:142950520-142950542 CAAAATGTCTAGAGAGAGGAAGG - Intronic
1034242212 7:149619294-149619316 TAGACTGAGGAGGAAGAGGAGGG - Intergenic
1035762686 8:2081096-2081118 CAGCCCGTGTAGAATGAGGTTGG + Intronic
1035762711 8:2081199-2081221 CAGCCCGTGTAGAATGAGGTGGG + Intronic
1036273323 8:7327793-7327815 GAGGCTGAGAAGAAAGAGGAAGG + Intergenic
1036348026 8:7982559-7982581 GAGGCTGAGAAGAAAGAGGAAGG - Intergenic
1036425403 8:8641386-8641408 CAGAGTGTGTAGGAGGAGGGAGG - Intergenic
1036843321 8:12143035-12143057 GAGGCTGAGAAGAAAGAGGAAGG - Intergenic
1036864685 8:12385350-12385372 GAGGCTGAGAAGAAAGAGGAAGG - Intergenic
1037656930 8:20892315-20892337 CACACTGTGTAGAAGGAGACAGG - Intergenic
1037889701 8:22617408-22617430 CTGCCTCTGTAGAAGGAGGATGG + Exonic
1037915861 8:22773107-22773129 CATACTGTGAAGAAATAGGTTGG - Intronic
1041437008 8:57853004-57853026 TAGACTGTGAAGAAAGAGCCAGG + Intergenic
1042082247 8:65067519-65067541 CAGACTAAGTAAAAAGAAGATGG - Intergenic
1042847265 8:73180971-73180993 TAGACTGTAGAGAAAGGGGAGGG - Intergenic
1044258308 8:90091553-90091575 CAGACTGTATAGAGGTAGGAAGG + Intronic
1044823381 8:96174075-96174097 CAGTCTGTGAAGAAAGAAGGGGG - Intergenic
1045081745 8:98633158-98633180 TAGAATGTGTAGAAAAAAGATGG + Intronic
1045405341 8:101860839-101860861 CAGACTGTTTAGAAATATGGAGG + Intronic
1045670689 8:104549958-104549980 CAGACTTTCTAGAAAGGGAAAGG - Intronic
1045870061 8:106916271-106916293 CAGACTGTATAGAAAGTAAAAGG - Intergenic
1047298870 8:123596002-123596024 CAGCCAGTGAAGAAGGAGGAGGG + Intergenic
1047566725 8:126051922-126051944 CCTTCTGTGTAGGAAGAGGAGGG + Intergenic
1048462384 8:134632148-134632170 TAGGCTGAGGAGAAAGAGGAGGG - Intronic
1048971817 8:139649388-139649410 CTGAGGGTGTAGAATGAGGAAGG + Intronic
1048982424 8:139709941-139709963 CACACTGTGCAGGAACAGGATGG + Intergenic
1048999284 8:139814402-139814424 CAGACTGTCTAGCAGGAGGGAGG + Intronic
1049955499 9:689198-689220 CAGACTGTGAAGAAAGCCTAAGG + Intronic
1050705574 9:8392851-8392873 CACACTGTGCAGAAAGATGAAGG + Intronic
1050768322 9:9164270-9164292 CTGACTTTGAAGATAGAGGAAGG - Intronic
1051579237 9:18652869-18652891 GAGACTGTCTAGAAACAGGCTGG - Intronic
1052044271 9:23776139-23776161 CAGGTTGTTTATAAAGAGGAAGG + Intronic
1052459685 9:28746983-28747005 AATACTGGGTAGAAAGAAGAGGG + Intergenic
1053594810 9:39548973-39548995 CTGACTGTGAAGATGGAGGAAGG + Intergenic
1053852595 9:42304006-42304028 CTGACTGTGAAGATGGAGGAAGG + Intergenic
1054451033 9:65403773-65403795 CAGGCTGTGTAGACAGGGCAGGG + Intergenic
1054571443 9:66815994-66816016 CTGACTGTGAAGATGGAGGAAGG - Intergenic
1054770447 9:69078459-69078481 GAGACTGTGTAGCTAGATGATGG - Intronic
1056493031 9:87126544-87126566 GAGTCTGTATAGACAGAGGAGGG - Intergenic
1056796660 9:89663298-89663320 CAGACTGTGCACAAAGAAAATGG + Intergenic
1058164901 9:101608165-101608187 CAGTGTGTGTAGAGATAGGAGGG - Intronic
1058615241 9:106819387-106819409 CAGACAGTTTAGAATGAGGGTGG + Intergenic
1059545855 9:115175958-115175980 CGGACTGTGTAGAAGTGGGAAGG + Intronic
1060103915 9:120862002-120862024 CAAACTGTGGAGACAGAAGAGGG + Exonic
1062071378 9:134556768-134556790 CAGAATGTATAGAAAGAGCCAGG - Intergenic
1062369272 9:136228975-136228997 CAGACTCTGTACAAATATGAAGG + Intronic
1062479015 9:136742959-136742981 CAGCCTGTGTCGGGAGAGGAGGG + Exonic
1203753947 Un_GL000218v1:106313-106335 GAGAGTGTGGAGAAATAGGAAGG - Intergenic
1186909839 X:14151105-14151127 GAGGCTGTGGAGAAATAGGAAGG - Intergenic
1186938441 X:14476896-14476918 TTGGCTGTGAAGAAAGAGGAAGG + Intergenic
1188455293 X:30357429-30357451 CAGAGTGTGGATAAAAAGGAGGG + Intergenic
1190063213 X:47223899-47223921 CAGACGGTGTTGAGAGAAGATGG - Intronic
1191009447 X:55745544-55745566 CAGCCTGTGTAGAAGAAAGATGG - Intronic
1192567335 X:72176147-72176169 GAGAATGTGGAGAAATAGGAAGG + Intergenic
1193886242 X:86986179-86986201 CAGACTGTGTAGAGGTGGGAAGG - Intergenic
1194792992 X:98174105-98174127 GAGACTGGGAAGAAAGAGAAGGG - Intergenic
1195998306 X:110753859-110753881 CAGACTGTGTAAGATGAGGTGGG - Intronic
1196316969 X:114238306-114238328 GAGAATGTGGAGAAATAGGAAGG - Intergenic
1197456125 X:126677611-126677633 GAGATTGTGTAGAAAAAGGAAGG + Intergenic
1197868373 X:131042439-131042461 CAGAGTCTGGAGAAAGAGGATGG + Intergenic
1198136631 X:133758061-133758083 GAGGCTGTGGAGAAACAGGAAGG + Intronic
1199576792 X:149320031-149320053 CAGACTGTATAGAGGTAGGAAGG - Intergenic
1199716338 X:150509567-150509589 CAGAGTATGTAGAAGGAGGGAGG - Intronic
1200744093 Y:6888130-6888152 GAGACTGTGGAGAAATAGGAAGG - Intergenic
1201167594 Y:11223960-11223982 GAGAGTGTGGAGAAATAGGAAGG - Intergenic
1201473227 Y:14355712-14355734 CAGACTGTGTAGAGGTTGGAAGG + Intergenic
1201866736 Y:18663855-18663877 AAGGATGTGTAGAAATAGGAAGG + Intergenic