ID: 1030253983

View in Genome Browser
Species Human (GRCh38)
Location 7:107486085-107486107
Sequence CAGAGATAAAGCTGAAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 508
Summary {0: 1, 1: 0, 2: 5, 3: 47, 4: 455}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030253982_1030253983 3 Left 1030253982 7:107486059-107486081 CCACACTCTATGAATGTAGAAAC 0: 1
1: 0
2: 3
3: 45
4: 363
Right 1030253983 7:107486085-107486107 CAGAGATAAAGCTGAAAAATAGG 0: 1
1: 0
2: 5
3: 47
4: 455

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030253983 Original CRISPR CAGAGATAAAGCTGAAAAAT AGG Intronic
901188054 1:7387648-7387670 CAGAGAAAAAGCTGCAAAACAGG + Intronic
902132337 1:14273348-14273370 CAGAGAAAAAGCTGAAAATTAGG - Intergenic
902358693 1:15928814-15928836 CAGAGAGAAAGCTGACAAAGAGG + Exonic
903163521 1:21505826-21505848 CAGAGATAAAGGAGAAAGAAAGG - Intergenic
903677916 1:25076628-25076650 CTTATATAAAGCTCAAAAATCGG + Intergenic
904846449 1:33422011-33422033 CAGAAATAAGGCTGAAAAGTAGG - Intronic
905053952 1:35077109-35077131 CAGTGATAGATCTGAAAATTTGG - Intronic
905787247 1:40768011-40768033 CAGAACTAAAGCCAAAAAATGGG + Intronic
905953289 1:41971396-41971418 CAAAGATGAATCTGGAAAATAGG - Intronic
906037051 1:42757330-42757352 CAGGGAAAATGCTGAAAGATGGG + Intronic
906274291 1:44504818-44504840 CAGAGACAAATTTGAAAAAAAGG - Intronic
906994326 1:50774609-50774631 TTGAGATATAGCAGAAAAATAGG - Intronic
907047363 1:51307431-51307453 GGGAGATAAAGATGATAAATAGG + Intronic
907677738 1:56534283-56534305 CTGAGATACATCTGAAAAAGAGG + Intronic
908172282 1:61517332-61517354 CAGAGAAGAATCTGAACAATCGG - Intergenic
908179774 1:61592255-61592277 TAAAGGTAAAGCTGGAAAATTGG - Intergenic
908957233 1:69648019-69648041 TAGAAATAAATCTGAAAAAAAGG - Intronic
909022470 1:70447509-70447531 AAGAGCTAAAACAGAAAAATTGG - Intergenic
909385311 1:75048478-75048500 CACAGTAAAAGTTGAAAAATTGG + Intergenic
909924168 1:81419062-81419084 CAGAACTAAAGCTCAAAAGTAGG + Intronic
910003642 1:82367517-82367539 AAGAGACACAACTGAAAAATTGG - Intergenic
910020473 1:82583514-82583536 CAGAGAGAAAGTTTAAAAAGTGG + Intergenic
910104170 1:83612757-83612779 CAGAGGTAGAACTAAAAAATGGG - Intergenic
910130035 1:83893560-83893582 CAGACATAAACATGAAGAATTGG + Intronic
910534442 1:88280598-88280620 CAGAGATTAAGCTGAGAAAATGG - Intergenic
910876579 1:91884488-91884510 CAAATAGAAAGCTGAAAGATGGG + Intronic
910897599 1:92084832-92084854 CAGAGATAAAGATGAATAAGAGG - Intronic
910990579 1:93052158-93052180 CACACACAAAGCTGACAAATTGG + Intergenic
911219221 1:95229544-95229566 CAAAAATAAAGCAGGAAAATAGG - Intronic
911710398 1:101064878-101064900 CATAGATAAAGCTGGTAAGTGGG + Intergenic
911953504 1:104207415-104207437 GAGAGATAAGGCTGAAAAATGGG + Intergenic
914814242 1:151051781-151051803 CAGAAATAGAGCTTAAAATTTGG + Exonic
915208822 1:154291258-154291280 CAGAAATTTAGCTGGAAAATAGG + Intergenic
915575181 1:156771097-156771119 CAGAGATAAGGCTGAAGAAAGGG + Intronic
915639324 1:157210455-157210477 TTGAGATTAAGATGAAAAATGGG - Intergenic
915802812 1:158812100-158812122 CATAGATAAAGCTGCAAATTGGG - Intergenic
915824896 1:159064977-159064999 CAGATTGAAAGCTGAAAACTGGG + Intronic
916263347 1:162864800-162864822 TTGAAATAAAGCAGAAAAATAGG + Intronic
916623606 1:166528674-166528696 CAGAGATCAAGTTAAAAGATGGG + Intergenic
916624445 1:166539846-166539868 CAGAGATCCAGTTAAAAAATAGG - Intergenic
917597435 1:176543435-176543457 CAGAGATGAAGCTGGAATGTGGG - Intronic
918817301 1:189205033-189205055 TAGTGATAAAGCAGAAACATAGG + Intergenic
919142651 1:193591838-193591860 CAGCCATAAAGCTGAAACAAAGG - Intergenic
919430098 1:197481823-197481845 CTGAGCTTAATCTGAAAAATGGG + Intergenic
920706161 1:208252153-208252175 CAGGGACAGAGCTGAGAAATAGG + Intergenic
921365343 1:214368499-214368521 GAGAAATAAAACTTAAAAATAGG - Intronic
921486631 1:215722880-215722902 CAGAAATAAATCTGATAATTTGG - Intronic
921489350 1:215755293-215755315 CACAGACAGAGCTGAATAATGGG - Intronic
921640462 1:217546730-217546752 CAAAGAAAAAGTTGACAAATGGG + Intronic
921921277 1:220672850-220672872 CAGATACAAAGCTGAAATCTAGG + Intergenic
921935474 1:220791954-220791976 CAAAGATCAAGCACAAAAATGGG + Intronic
923487694 1:234451445-234451467 CAAAGATAAAACTGATGAATGGG + Intronic
924393263 1:243587122-243587144 CAGAGACAAAACTTAAAAAAGGG + Intronic
1062999512 10:1902106-1902128 AAGATATAAAGATGAAAAATAGG - Intergenic
1063735620 10:8750335-8750357 CAGAAATAAAGATAAAATATAGG + Intergenic
1064236901 10:13584652-13584674 GAGAGATAAAAATGAAAAATTGG - Intergenic
1065040194 10:21685990-21686012 GAGACATAAAGATGAAAACTAGG + Intronic
1065499026 10:26360706-26360728 CAGAGAGAAGGCTCAAACATGGG - Intergenic
1065742535 10:28810345-28810367 CAGAGAGAAGGCAGAGAAATGGG + Intergenic
1066296456 10:34058093-34058115 CAGAGATGAACATGACAAATTGG + Intergenic
1067396811 10:45927974-45927996 TAAAGATAAAACTGAAAAAGGGG - Intergenic
1067865131 10:49897067-49897089 TAAAGATAAAACTGAAAAAGGGG - Intronic
1068202673 10:53803164-53803186 CAGCGATAAGGCTGAAGGATAGG - Intronic
1068976909 10:63020114-63020136 CAGAGTTACAGTTGCAAAATGGG - Intergenic
1069024717 10:63527210-63527232 AAGAGATGAAGCTGAAAAGAAGG - Intronic
1069256554 10:66338551-66338573 TAAAGAAAAAGCTGAAAACTTGG + Intronic
1069662882 10:70135338-70135360 CAAAGATAAAGCTGGAAGAGAGG + Intergenic
1070012957 10:72494931-72494953 CTGAGATAAAGCTCATAGATAGG - Intronic
1070653228 10:78253044-78253066 CACAGAAAAGGCTGAGAAATTGG + Intergenic
1073030731 10:100523662-100523684 CAGACATCAAGCAGAAAAAAAGG + Intronic
1073108053 10:101043987-101044009 CAGAGATGGAGGTGAACAATAGG + Intergenic
1073345051 10:102776695-102776717 CGGAGAAACAGCTGAAGAATGGG + Intronic
1073597228 10:104813075-104813097 CTGAGATGAAGTTGAAAAAATGG - Intronic
1073821282 10:107267247-107267269 CAGAGATCCAGCTTATAAATTGG - Intergenic
1075825197 10:125350358-125350380 CAGGCATGAAGCTGAAAACTAGG + Intergenic
1075933569 10:126320843-126320865 CAAAGATAATTGTGAAAAATGGG + Intronic
1076447004 10:130522533-130522555 CAGAGATAAATTTGAACATTGGG + Intergenic
1076573474 10:131448563-131448585 CAGATAGAAAACTGAAAAAGGGG + Intergenic
1077318885 11:1932027-1932049 CAGAGAGAAAGATGAAAGAGGGG + Intronic
1077738595 11:4819429-4819451 CAGAGAAAGAGCTGATTAATGGG + Intronic
1077779391 11:5309026-5309048 CTAAGATAAAGCTGTAAAAGAGG + Intronic
1077807867 11:5607593-5607615 CAGTGATAAAGGTGAACAACTGG + Intronic
1077995279 11:7447247-7447269 CAGAGAGAAAGATGGAGAATTGG - Intronic
1079582128 11:22078838-22078860 GAGACATAAAGCTGAAATTTTGG + Intergenic
1079892437 11:26073554-26073576 CAGAGATAAAATTGAAATTTAGG + Intergenic
1080067928 11:28041675-28041697 AAGAGAGAAAACAGAAAAATCGG + Intronic
1080769498 11:35327247-35327269 TTGAGCTAAAGTTGAAAAATAGG + Intronic
1081055436 11:38404998-38405020 CATAGATAAAGATGAAAAAAAGG + Intergenic
1081134356 11:39420502-39420524 TAGAGAGAAAGCTTAAGAATCGG - Intergenic
1081234556 11:40631469-40631491 CAGACATATGGCTGCAAAATAGG + Intronic
1082562263 11:54632564-54632586 AAGATATGAAGCTGGAAAATAGG - Intergenic
1082717147 11:56628108-56628130 CAAAGAAAATGCTGAAAAGTGGG + Intergenic
1085107508 11:73858214-73858236 CAGAGATAATGCTGAAAAGCAGG + Intronic
1085919666 11:80937474-80937496 CAGACATTAAAATGAAAAATAGG - Intergenic
1086143480 11:83524675-83524697 CAGAGATAACGCAGAGAAGTTGG - Intronic
1087420683 11:97921912-97921934 GACAGATAAAGCTGAAATGTTGG + Intergenic
1087632381 11:100665523-100665545 CAGAGAAAAGTGTGAAAAATAGG + Intergenic
1087883947 11:103455191-103455213 GGTAGATAAAGCTGAAAAACAGG + Exonic
1088603240 11:111502549-111502571 AAGGGACAAAGCTGAAAATTAGG + Intronic
1089358756 11:117872811-117872833 CAGAGATGATGCTGCCAAATTGG + Intronic
1090373897 11:126275768-126275790 CAGAGAAGAAAATGAAAAATAGG - Intronic
1090531331 11:127593845-127593867 CAAAGAAAATGCTGAAAACTTGG - Intergenic
1091161103 11:133421567-133421589 CAGAGATAAAATTGAAAACTGGG + Intronic
1091181542 11:133608739-133608761 CAGAGATAAAGATACAAACTTGG - Intergenic
1091506651 12:1076143-1076165 CAAAAATAAAGCTCACAAATGGG - Intronic
1091917207 12:4278284-4278306 CACAGATAAAGCTCAAAATAAGG - Intronic
1092490449 12:8940146-8940168 CAGAGATGGAACTGAAAAACAGG - Exonic
1093341703 12:17982954-17982976 TATGGATAAAGCTGACAAATGGG + Intergenic
1094130519 12:27069711-27069733 CAGAGATGAAGCTGAACAAGGGG - Intergenic
1094179925 12:27581384-27581406 CAGAGATGAAGCTGGACAAGTGG - Intronic
1094240917 12:28223788-28223810 TCTAGATAAAGCTTAAAAATTGG - Intronic
1094487488 12:30936619-30936641 AAGTGATAAAGCTGAGAAAAAGG + Intronic
1094750422 12:33399934-33399956 CAGAGATGAAACAGAAAACTAGG + Intronic
1095769512 12:45937401-45937423 CAGACCCAATGCTGAAAAATAGG - Intronic
1096946039 12:55411013-55411035 CAGAGATGGAACTGAAAAACAGG + Intergenic
1097325408 12:58270880-58270902 GAGAGAGAAATCTTAAAAATTGG - Intergenic
1097660963 12:62430766-62430788 AACAAATAATGCTGAAAAATTGG + Intergenic
1098198224 12:68024981-68025003 TAGAGGTAAAACTGAAAATTAGG - Intergenic
1098794059 12:74866101-74866123 CAGAGATATAGCTTTTAAATGGG + Intergenic
1098867021 12:75774725-75774747 TAAAGATAAAACTAAAAAATGGG - Intergenic
1099085292 12:78239056-78239078 CAAAGAAAAAGCTGAATAACTGG + Intergenic
1099858216 12:88196899-88196921 CAAATTTAAACCTGAAAAATAGG + Exonic
1099994299 12:89760887-89760909 CTTTTATAAAGCTGAAAAATAGG + Intergenic
1100274149 12:93056246-93056268 CAAAGATAAAGATAAAAACTTGG + Intergenic
1100607553 12:96163955-96163977 TAGAGAAAAAGCTTAAACATAGG - Intergenic
1100892646 12:99142954-99142976 TAGAGATAGAGCTGAACATTTGG - Intronic
1101184805 12:102264507-102264529 AAGACAAAAAGCTGAAAAACAGG - Intergenic
1101211563 12:102539977-102539999 CACAGATCAAACTGAAAAACAGG - Intergenic
1102417367 12:112775758-112775780 AAAAGATAAAGATAAAAAATGGG + Intronic
1103766521 12:123284025-123284047 CAGAAACAAAACTGAAAATTAGG - Intergenic
1104242686 12:127005979-127006001 CAGAAAAAAACCTGAGAAATCGG + Intergenic
1104468756 12:129011442-129011464 GAGAAATAAAGCAGAAAAAGAGG - Intergenic
1104999928 12:132683856-132683878 CAGTAAGAAATCTGAAAAATGGG + Intronic
1106249251 13:27971485-27971507 CAGAGACACAGCTGGAAAACAGG - Intergenic
1106682825 13:32025766-32025788 CATAGACAAAGCTGAACAAAGGG - Intergenic
1107609339 13:42097317-42097339 AAGACAAAAAGATGAAAAATGGG - Intronic
1108183942 13:47870069-47870091 CAGAGTTAAAGCTGTAGATTTGG - Intergenic
1108217076 13:48195839-48195861 CAGAAATAAGGATGAAAAAGTGG + Intergenic
1108221325 13:48236053-48236075 AAAAGATAAGACTGAAAAATGGG - Intronic
1109387891 13:61656591-61656613 CATAGATAAACCTCAAAATTAGG - Intergenic
1110490100 13:76093313-76093335 CACAGATCAAACTGAAAGATGGG - Intergenic
1110521281 13:76479810-76479832 CATAGCAAAAGCTGAAAAACAGG - Intergenic
1110862935 13:80363575-80363597 CAGATATACAGTGGAAAAATAGG - Intergenic
1111146660 13:84190779-84190801 GAGTAATAAGGCTGAAAAATGGG + Intergenic
1112673331 13:101667289-101667311 CAGAGATAAAATAGAAAAATAGG - Intronic
1114863847 14:26562625-26562647 CAGAGAGGAAGCTGAAAACTAGG + Intronic
1115244489 14:31281301-31281323 CAGAGAAAAAGGAGATAAATTGG - Intergenic
1115654254 14:35428110-35428132 CAGAGAAACAGCTTGAAAATGGG + Intergenic
1115678251 14:35705977-35705999 AAGAGAACAACCTGAAAAATGGG - Intronic
1115843411 14:37498123-37498145 CAGACAAAAAGTTTAAAAATAGG + Intronic
1116091281 14:40309974-40309996 CAGAGATCAAGATGATAATTTGG + Intergenic
1116158760 14:41239507-41239529 TAGAGAAAGAGCTGAAAATTTGG - Intergenic
1116513170 14:45771641-45771663 CAAAAATAAAACTGAAAAAAAGG - Intergenic
1116673668 14:47876979-47877001 AGGAAATAAAGTTGAAAAATCGG + Intergenic
1116740962 14:48753875-48753897 AGAAGATAATGCTGAAAAATTGG + Intergenic
1117543568 14:56771752-56771774 CAGAGACAAGGCAGAAAAAGGGG + Intergenic
1117570993 14:57049258-57049280 CAGCGGTAAAGCTGAATATTGGG - Intergenic
1118644192 14:67820971-67820993 CAGAGAAAAACATCAAAAATTGG - Intronic
1118810091 14:69266921-69266943 CAGAGACAAAGCTGCAAAGTTGG + Intronic
1118968071 14:70606841-70606863 GAGAGATAATGCTGAAAAGTAGG - Intergenic
1120992773 14:90392834-90392856 CAAAGATTAAGATGAAAATTTGG - Intergenic
1122336021 14:100985001-100985023 AATAGATACAGCTGAAAAAGTGG + Intergenic
1123917224 15:25043997-25044019 CAGAAATAAAGGAAAAAAATTGG - Intergenic
1128190595 15:65691281-65691303 TGGAGATATAGTTGAAAAATTGG - Exonic
1128972606 15:72120430-72120452 CAGAGATGAAGATGATAAAGTGG + Intronic
1130422803 15:83764879-83764901 CAGAGATGAAGCTGAACAAAGGG + Intronic
1130921763 15:88352135-88352157 GAGAGATGAAGCTGAATAGTGGG - Intergenic
1131329591 15:91484769-91484791 CAGAGAGACATCTGAAAAAGGGG + Intergenic
1133465498 16:6023177-6023199 CAGAAATGAAGCTGAAACATGGG + Intronic
1133653327 16:7834162-7834184 CATATATAAAGTTCAAAAATAGG + Intergenic
1133892846 16:9897365-9897387 CAGAGATAACATTGAAAAATAGG + Intronic
1134114963 16:11541144-11541166 CATAGATACAGATGACAAATTGG - Intergenic
1135357053 16:21778005-21778027 CAAATATAAATCTGCAAAATGGG - Intergenic
1135455557 16:22594119-22594141 CAAATATAAATCTGCAAAATGGG - Intergenic
1137030146 16:35516119-35516141 AAGAAAAAAAGCAGAAAAATGGG + Intergenic
1137831136 16:51544430-51544452 CAGAGAGAAGACTGAAAACTAGG - Intergenic
1137859139 16:51828784-51828806 CAGAGATAAAACTGGAAACCAGG + Intergenic
1138410610 16:56836877-56836899 CAGAAATAATGCTGTAAAATGGG - Intronic
1139664042 16:68443799-68443821 CAGAAATAAAACTGAACTATTGG - Intronic
1139790567 16:69430972-69430994 CACATATAAAGCTTTAAAATAGG - Intronic
1140353329 16:74283351-74283373 CAGAGAGAAACCTTAAAAATTGG + Intergenic
1141399840 16:83738062-83738084 GAAAGTTAATGCTGAAAAATAGG + Intronic
1143915655 17:10290544-10290566 GAGAGATAAAGAAGAAACATTGG - Intergenic
1144670391 17:17129538-17129560 CAGAGATTAAGTTGCATAATGGG + Intronic
1146235404 17:31155712-31155734 CAGAAAGAAAGCTGCAAAAATGG + Intronic
1146825559 17:36019510-36019532 CAGAGATAAAGCTGATAGAATGG + Intergenic
1147566852 17:41541776-41541798 CAGACAGAAAGCAGAAAACTAGG - Intergenic
1148545765 17:48517789-48517811 CAGAGGTAATACTGAAAAAGAGG + Intergenic
1148934320 17:51152584-51152606 CAGGGAAAAAGTTGATAAATTGG - Intergenic
1148948907 17:51291433-51291455 CAGAGATAAAGTTTAAAAATAGG + Intronic
1149630155 17:58115728-58115750 CAGAAATAAAGCACAAAAGTAGG - Intergenic
1149953788 17:61022137-61022159 CACTGATATAGCAGAAAAATTGG - Intronic
1150027711 17:61695030-61695052 CAAAGAAAAAGCAGATAAATTGG - Intronic
1150518534 17:65840614-65840636 CAAAGCAAAAGCAGAAAAATGGG + Intronic
1150616867 17:66778977-66778999 CAGAGAGAAAGATGAAGAAGGGG - Intronic
1152603214 17:81275867-81275889 CAGAGATATAGCAGGAAAGTGGG - Intronic
1153157733 18:2168057-2168079 CAGCCATAAAACTGAAAAATGGG + Intergenic
1153524459 18:5981050-5981072 CAGAGAGAAACCTGAAAAACAGG - Intronic
1155372925 18:25122349-25122371 CAGAAAAATATCTGAAAAATAGG + Intronic
1155778675 18:29801953-29801975 CAGAGAAAACACTGATAAATTGG + Intergenic
1156351625 18:36306951-36306973 AAAAAATAAAGCTCAAAAATAGG - Intronic
1156511322 18:37639359-37639381 CTGAGATTATACTGAAAAATGGG - Intergenic
1159518344 18:69487297-69487319 AATAGAAAAAGGTGAAAAATAGG - Intronic
1159748286 18:72267934-72267956 CAGAGGTAAGGCTGAAAGAATGG - Intergenic
1161501912 19:4620900-4620922 CAGAGATGAAGCTGACAGACAGG + Intergenic
1162150040 19:8638623-8638645 CAGAAATAAAGATGAAGAGTTGG + Intergenic
1162663734 19:12192587-12192609 CAGAAAAAAAGCTGTAAAACAGG - Intergenic
1163343263 19:16723658-16723680 AACAGAAAAAGCTGTAAAATAGG - Intronic
1164232854 19:23306419-23306441 CAGCGCTAAAGCAGAAGAATAGG - Intronic
1165477627 19:36040305-36040327 AAAAGATGAAGCTGAAAAAAGGG - Intronic
1168238288 19:55076756-55076778 CAGGGACAATGTTGAAAAATTGG + Intronic
1168381753 19:55929938-55929960 CAGATGTAAAGCAGAAAACTAGG - Intronic
926388734 2:12365106-12365128 CAGAGAAAAAGCTGGTAGATGGG + Intergenic
927506275 2:23616926-23616948 CAGAGAGAATGCTCAGAAATGGG - Intronic
927634926 2:24806816-24806838 TAGAGAGAAAACTGAAAAAAGGG - Intronic
929147606 2:38720296-38720318 CATAGAAAATGCTCAAAAATTGG + Intronic
929767374 2:44857272-44857294 CCAAGATAAATCTGAAAAAGAGG + Intergenic
929827537 2:45320900-45320922 TAGGAATAAAGCTGAAAAAGAGG - Intergenic
930181091 2:48358296-48358318 AAGAGACATAGCTGCAAAATAGG - Intronic
930997516 2:57738473-57738495 GAGAGAGAAAGGTGAAGAATGGG + Intergenic
931460456 2:62445671-62445693 GAGAGAAAAAGCAGAAAAAATGG - Intergenic
931984679 2:67730294-67730316 CAGTGAATAAGCTGAAAATTGGG - Intergenic
932109383 2:68981501-68981523 GAGAGATGAGGCTGAAAATTTGG - Intergenic
932161226 2:69462061-69462083 CAGAGATAATCCTGAATATTTGG + Intronic
933384961 2:81598278-81598300 TATAGAAAAAGCTGATAAATTGG + Intergenic
933702195 2:85263424-85263446 CAGAGATGAAGGGGAACAATTGG + Intronic
933866975 2:86528802-86528824 CAGAGATGAAGCAGAAAAGGAGG + Intronic
934485896 2:94709953-94709975 CAGGGATGAAACTGAGAAATCGG - Intergenic
935742365 2:106160964-106160986 CACATACAAAGCTGAAAAACAGG + Intronic
935920558 2:108008530-108008552 CAGAGATACTGCAGAACAATTGG - Exonic
937743010 2:125377899-125377921 CAAAAATAAAGCAGAAAATTGGG - Intergenic
937828290 2:126391558-126391580 CTGAAATAGAGCTGAGAAATTGG - Intergenic
937965434 2:127504753-127504775 CAGTGATGAAGATGAAAAAGAGG - Exonic
938772324 2:134511120-134511142 CAGAGACAAAGCAGAAAAAAGGG + Intronic
939034679 2:137116575-137116597 AAAAGTTGAAGCTGAAAAATAGG - Intronic
939435059 2:142165524-142165546 CAGAGATGAGGCTGCACAATGGG - Intergenic
939444006 2:142285745-142285767 TAGAGACCAAGTTGAAAAATTGG - Intergenic
939949745 2:148455776-148455798 CAAATAGAAAGCTGAAAAGTAGG + Intronic
940372442 2:152918247-152918269 CAGACAGAGAGCTGAAACATGGG + Intergenic
940372806 2:152921620-152921642 CAGAAATAAAGCTGATAATCTGG + Intergenic
940373759 2:152931950-152931972 CAGAGAGAAAACAGAAAAAAAGG + Intergenic
940584590 2:155629796-155629818 AAGAGATAAAGCTAGAAGATGGG + Intergenic
941819690 2:169831934-169831956 CACAAATACAGCTGAAAAAAAGG - Intronic
942255724 2:174095839-174095861 CAGAAATTAAGTTTAAAAATAGG + Intronic
942591949 2:177555672-177555694 TAGAGATAAAGCTGAAAGATAGG - Intergenic
942768805 2:179489680-179489702 CAGAGACAAAGCTACAATATAGG + Intronic
943447457 2:188005597-188005619 TAAAGATAAAACTGAAAGATTGG - Intergenic
943522117 2:188965298-188965320 CATAGATAAAGGCAAAAAATGGG - Intergenic
943693268 2:190891952-190891974 CTGAGCTAAACCTGAAAGATGGG - Intronic
943710487 2:191089271-191089293 AAGATATATAGATGAAAAATAGG + Intronic
944272403 2:197797911-197797933 AAGAGATAAATGAGAAAAATGGG + Intergenic
947379103 2:229527797-229527819 CAGAAAGAAAGCTGATACATAGG - Intronic
947523986 2:230867450-230867472 CAGAGCTACAGCTGAGAAATGGG - Intronic
947743935 2:232497948-232497970 CAGAGATAAAGCTGAGACTTGGG + Intergenic
948387519 2:237590871-237590893 CCGGAATAAAGCTGAAAAACGGG - Exonic
1169331274 20:4718269-4718291 AATAGTAAAAGCTGAAAAATAGG + Intergenic
1169489517 20:6059139-6059161 CAGAGATAAGCCAGAAGAATGGG + Intergenic
1169627286 20:7585701-7585723 CACAAATAAAACAGAAAAATTGG - Intergenic
1170750956 20:19144574-19144596 CAGAAAGAAATCTGGAAAATCGG + Intergenic
1172247360 20:33455134-33455156 CATAGAGAAAGAAGAAAAATGGG + Intergenic
1172491586 20:35343249-35343271 CTGAAAAAAAGCTGAAAACTTGG + Intronic
1173110949 20:40189685-40189707 CAGATATAAAGCACAAATATGGG - Intergenic
1173679914 20:44871136-44871158 AAGACAAAAAGATGAAAAATTGG + Intergenic
1175329810 20:58155801-58155823 CAGAGAGAAGGCAGGAAAATGGG + Intronic
1177822342 21:26045088-26045110 AAGAGATAATGCAGAAAAAAAGG + Intronic
1177823803 21:26060600-26060622 CATAGATAAAGCAGAGAAAGGGG + Intronic
1178088086 21:29133155-29133177 CATAGAAAAAGCTCAAAACTAGG + Intronic
1178726837 21:35060550-35060572 CAGAAATAAAGCTGCACACTTGG - Intronic
1182303669 22:29353221-29353243 CAGAGAGAAAGGAGAAAACTGGG + Intronic
1183123311 22:35749664-35749686 AAGAGTGAAAGCTGAAAAAACGG - Intronic
1184917518 22:47580686-47580708 CAGAGATCCAGTTGAAAGATAGG + Intergenic
950380661 3:12611800-12611822 AAGAGATAATTCAGAAAAATAGG - Intronic
950925836 3:16741052-16741074 CAGCTATAAAGCAGAAAAAAAGG + Intergenic
951190577 3:19765290-19765312 CAAAAATAAAGCAGAAAAAGAGG + Intergenic
951747479 3:25995583-25995605 CAGAGATACAGCAAAAAAAAAGG - Intergenic
952011007 3:28901362-28901384 CAGGAATAAAGCTTATAAATGGG - Intergenic
955588898 3:60513562-60513584 CATGGACAAAGCTGAAAGATTGG - Intronic
955671683 3:61409140-61409162 AAGAGATAAAGCTGAAAGGATGG - Intergenic
956115248 3:65911437-65911459 CTGAGAAACACCTGAAAAATGGG - Intronic
956265271 3:67389303-67389325 CAGAGATGAAGCTGCAACACTGG + Intronic
956307854 3:67846177-67846199 GAAAAATAAAGCAGAAAAATTGG - Intergenic
956455059 3:69412485-69412507 AAGAGATAAAGGTGGAATATGGG + Intronic
956553558 3:70490538-70490560 CAAAGATGAAGCTTAAAATTAGG - Intergenic
956555251 3:70514510-70514532 CATATATAATGCTGAAAAAATGG - Intergenic
956976230 3:74583416-74583438 CCTAGATAAACCTGAAAAATAGG + Intergenic
957115748 3:76023094-76023116 GAGAGATGAAGAAGAAAAATTGG - Intronic
957579689 3:82055146-82055168 CAGAAAGAAAGCTGAATTATGGG - Intergenic
957738043 3:84227204-84227226 CACAGATAAAACAGAAGAATAGG + Intergenic
958753741 3:98225083-98225105 CAGAGACAAACCAGAAAAAGCGG - Intergenic
959828084 3:110824775-110824797 AAGAGATAAAGAGGAAAAAAGGG + Intergenic
960179095 3:114553424-114553446 CAGTGAAAAATCTGAAAAATTGG + Intronic
960505901 3:118493567-118493589 CAGGCATAAAGATGAAAAAAAGG - Intergenic
960537687 3:118831423-118831445 CAGTCATAAATCTGAAAAAGGGG - Intergenic
961019059 3:123488618-123488640 CAAAGATAAAGGTGAAAAACAGG + Intergenic
961078053 3:124000120-124000142 CAAATATGAAGCTGAAATATAGG + Intergenic
961321034 3:126075963-126075985 CAAAGAAAAAACTGACAAATTGG + Intronic
963221622 3:142819281-142819303 CAGAAATAAATCAGAAAAAAAGG + Intronic
963337255 3:143989505-143989527 CACAGATAAACCTGAAAATTGGG + Exonic
963809944 3:149766402-149766424 AAGAGAGAAAACTGAAATATGGG - Intronic
964052682 3:152415714-152415736 AAGAGCTAAAGTTGAAAAACTGG + Intronic
964547869 3:157855021-157855043 AGTAGATAAAGCTGAAAAAGGGG + Intergenic
966672631 3:182545004-182545026 CAGAGCTCATGGTGAAAAATAGG - Intergenic
966904026 3:184508783-184508805 CAGGCATAAAGCTGATACATGGG + Intronic
967340318 3:188389994-188390016 AAGAGATAAAACTGAGAAAGTGG + Intronic
967438165 3:189475642-189475664 AGGGGATAAAGCTGAAATATTGG - Intergenic
967558567 3:190890709-190890731 AAGAGATTAAACTGAAAAAATGG + Intronic
967744074 3:193035334-193035356 CAGAGAAAAACCTGAAGCATGGG - Intergenic
969078028 4:4595930-4595952 CAAAGATAAAGCTGGAGAAGGGG - Intergenic
970111857 4:12646449-12646471 CAGATAGAAAGCTGAAAGAAAGG + Intergenic
970359593 4:15295572-15295594 CTGAGATAAAACTGAAAGATAGG + Intergenic
971686289 4:29773536-29773558 TAGAGATAAAGTTTAAAAATGGG - Intergenic
971699632 4:29953937-29953959 CAGAGCTATTGCTCAAAAATTGG + Intergenic
971750649 4:30642993-30643015 CAGAGGTAAAGTTGAAAAGAGGG - Intergenic
972053163 4:34765548-34765570 GAGAAAAAAAGGTGAAAAATGGG + Intergenic
972695024 4:41436820-41436842 GAGATATAAAGCAGAAAATTAGG + Intronic
973054055 4:45631545-45631567 TAGACAAAAAGTTGAAAAATGGG + Intergenic
973064504 4:45771653-45771675 TATAAATAAAACTGAAAAATAGG + Intergenic
973796273 4:54430412-54430434 AAGAGATAAAGTTCTAAAATAGG + Intergenic
975667227 4:76744102-76744124 AAGAAATAAAGCTAAAACATAGG + Intronic
976022138 4:80641921-80641943 TAAAGATAAATCTGTAAAATCGG + Intronic
976839485 4:89414520-89414542 CTGAGATAAGTCTGAAAAATAGG + Intergenic
979102243 4:116633197-116633219 CAGACATAAAGCATAGAAATAGG + Intergenic
979579199 4:122335937-122335959 AAAATATAAAGCTGAAAAACTGG + Intronic
980164992 4:129215152-129215174 CACAGACAAAGCAGAAAAAGAGG - Intergenic
982239170 4:153281354-153281376 GGAAGATAAAGCTCAAAAATTGG + Intronic
982473503 4:155822555-155822577 CAGAGTTAAGGATGAGAAATGGG - Intergenic
983314906 4:166118906-166118928 CAGAGAAAAGGCTGCAGAATGGG + Intergenic
983444507 4:167832777-167832799 TACAGATATAGCTGCAAAATTGG - Intergenic
983600537 4:169521843-169521865 AAAAGACAAATCTGAAAAATGGG - Intronic
983636804 4:169905923-169905945 ACAAGATTAAGCTGAAAAATAGG + Intergenic
985485094 5:144291-144313 CAGAGACAAAGCTTTTAAATTGG + Intronic
986260826 5:6144973-6144995 CAATGAAAAAGCAGAAAAATGGG - Intergenic
986768665 5:10951206-10951228 CAAAGAGATAACTGAAAAATAGG + Intergenic
987785820 5:22497438-22497460 CAGAGATACAGCAGAATAACGGG - Intronic
987919492 5:24260325-24260347 TAGAGATGAAACTGAAAATTTGG + Intergenic
988130877 5:27104625-27104647 AAGAGACAAAGCTGAAATAGTGG + Intronic
988423615 5:31036905-31036927 CAGATATAAAACTGCAAAAAAGG + Intergenic
988468333 5:31512691-31512713 CAGAGATACAACAGAAAAAGAGG + Intronic
988640665 5:33037718-33037740 CAGAGATAAAGTGGAAAGGTAGG + Intergenic
989760891 5:45014965-45014987 CATTGGTAATGCTGAAAAATGGG - Intergenic
990146635 5:52768491-52768513 CAGAAAGAAAGCTGAGAAGTTGG - Intergenic
990675719 5:58182310-58182332 CAGATATAAAATTGAAAATTTGG + Intergenic
990807642 5:59683979-59684001 CAAAGAGAAATCTGCAAAATTGG - Intronic
991039908 5:62164440-62164462 TAGAGATAAAGAGGAAAAAGTGG + Intergenic
991630051 5:68647517-68647539 CAGAAATAAAGCTACAAAACTGG + Intergenic
991670243 5:69040027-69040049 AAAAAATAAAGCAGAAAAATGGG - Intergenic
991964534 5:72078045-72078067 CAAAGAAAATGCTCAAAAATTGG - Intergenic
992218403 5:74547805-74547827 CAAAGACAAACTTGAAAAATTGG + Intergenic
992539077 5:77744017-77744039 AAGACATAAAGCTGATAAATTGG - Intronic
992840856 5:80690892-80690914 AACAGATAAAACTGAAAAAAAGG - Intronic
992914760 5:81437045-81437067 GAGAGATAAATTTGAAAAAGTGG - Intronic
992984106 5:82209919-82209941 CAAAGATAAAACTGAAAGACTGG - Intronic
993081944 5:83312074-83312096 CACACAGAAAGCTGAAGAATAGG + Intronic
994292607 5:98046823-98046845 CTAAGATGAAGCTGAAAAACTGG + Intergenic
995084173 5:108088419-108088441 CAGAGGAGAAGCAGAAAAATGGG - Intronic
995279837 5:110321521-110321543 CATAGGTAAAACTTAAAAATAGG - Intronic
995392913 5:111659340-111659362 CAGAGAGAAAACTGACAAAATGG - Intergenic
995802621 5:116015130-116015152 CAGATATAAAGGTCAAAAGTAGG - Intronic
996407319 5:123118334-123118356 AAGAAATAAGGCTGATAAATTGG + Intronic
996942013 5:129019338-129019360 CATAGATAAAGCTTGAAAAAAGG + Intronic
997751219 5:136347701-136347723 CAAAGATCAAGGTGAAAAATTGG + Intronic
998182784 5:139956888-139956910 AGGACACAAAGCTGAAAAATGGG + Intronic
998904489 5:146889869-146889891 CAAAGTTATAGCTAAAAAATGGG + Intronic
1000535697 5:162475685-162475707 TAGAGATAAAACTGCTAAATAGG - Intergenic
1000944320 5:167401704-167401726 CATACCTAAAGCTGGAAAATAGG - Intronic
1000971428 5:167718880-167718902 CACATAAGAAGCTGAAAAATGGG - Intronic
1001239590 5:170057899-170057921 CAGTAATAAAGCTGATGAATGGG + Intronic
1001263020 5:170249019-170249041 CATAGATAAAGATAAAATATGGG + Intronic
1002618218 5:180468553-180468575 CTGAGATAAAGCTGGAAAGAGGG - Intergenic
1002834659 6:855857-855879 CAGAGATAATGAGGAAAAACAGG - Intergenic
1003203544 6:3986625-3986647 CAGAGGTGAAGTTTAAAAATAGG - Intergenic
1003205840 6:4010443-4010465 GAAAGATTAAACTGAAAAATAGG + Intergenic
1004138696 6:12993599-12993621 CATAGATAAATCTGGAAATTGGG + Intronic
1004526239 6:16410815-16410837 CAGTGCTAAAGATGGAAAATAGG + Intronic
1004594178 6:17083381-17083403 CAAAGAGAAAGCTAAAAAAATGG - Intergenic
1005804810 6:29464298-29464320 CTGAAATAAAGGTGAAATATTGG + Exonic
1006661350 6:35648204-35648226 CAGAGACAAAGATGAAAAATGGG - Intronic
1007501309 6:42299704-42299726 CAGAGATAAAAATGTAAAAAAGG + Intronic
1008205569 6:48652530-48652552 CAGAGACTAAAGTGAAAAATGGG - Intergenic
1008261786 6:49375150-49375172 CTGAGATTAAGTAGAAAAATTGG - Intergenic
1008788003 6:55193639-55193661 CATAGGTAAAACAGAAAAATGGG - Intronic
1008854934 6:56072437-56072459 CAGAGATAAGGCTGAAACTGAGG - Intronic
1008982560 6:57501987-57502009 TAGAAATAAAGCAGAAATATTGG - Intronic
1009170628 6:60394850-60394872 TAGAAATAAAGCAGAAATATTGG - Intergenic
1009867876 6:69419537-69419559 CAGAGGTTAAACTGTAAAATAGG - Intergenic
1010700965 6:79046379-79046401 CAAATATAAAGCTGAATAAAAGG - Intronic
1010899181 6:81404525-81404547 CAGAGATAAAGCTGGAGAAATGG - Intergenic
1010922373 6:81699060-81699082 CAGACATAAACCTCAAAAAGAGG - Intronic
1011106764 6:83790751-83790773 CAGAGCAAAAGCTATAAAATGGG - Intergenic
1011442848 6:87405823-87405845 AAGAGAGAAAGCAGAAATATGGG + Intergenic
1011717956 6:90126880-90126902 AAAAGATAAAACTGCAAAATGGG + Intronic
1011719098 6:90136711-90136733 CACAGATTAAGATGAAAAAAAGG + Intronic
1011841668 6:91508586-91508608 CACAGAGAAAGCTGAAAAGCTGG - Intergenic
1012222451 6:96665528-96665550 AAAAGAAAAAGCTGAAAAAATGG + Intergenic
1012506529 6:99953102-99953124 CAGAGACAAAGTTGTAAAAAAGG - Intronic
1013824806 6:114198516-114198538 CAGAGTTAATGCAGAAAAATAGG + Intronic
1014036038 6:116767391-116767413 CCAAGATATAGCTGAAAAATTGG + Intergenic
1015051723 6:128848852-128848874 CAATCATAAAGCTAAAAAATGGG - Intergenic
1015625123 6:135173770-135173792 AAGAGATAAGGCTGAAAGGTAGG + Intergenic
1016143321 6:140640577-140640599 CAGGGAGAAAGCTGGAAAACAGG - Intergenic
1016171205 6:141019237-141019259 AAGAGGAAAAGCTGATAAATTGG - Intergenic
1016647554 6:146427287-146427309 AAGAGCTAAAGGTCAAAAATGGG - Intronic
1017029015 6:150204722-150204744 CAGAGATGAAACTGAAACCTGGG + Intronic
1017149836 6:151269011-151269033 CAGAGGGAAAGTTGAAAATTGGG + Intronic
1017307651 6:152937798-152937820 GAGAGAGAAAGATGAAAATTTGG - Intergenic
1017606835 6:156143947-156143969 AGGAGATAAAGCTGAAAATGTGG + Intergenic
1019032778 6:169026870-169026892 CAAAAATAAAGAAGAAAAATGGG + Intergenic
1020852376 7:13372561-13372583 CAGTGTTAAAACTCAAAAATAGG + Intergenic
1021518515 7:21514283-21514305 CAGTTATAAAATTGAAAAATAGG - Exonic
1021806795 7:24365497-24365519 GAGAGATAACCCTGAAAAAATGG - Intergenic
1021817940 7:24466476-24466498 CAGAAAGAAAGCTTAAAAACAGG + Intergenic
1021827659 7:24571713-24571735 CAGAGACAAAGCGGAAGGATGGG - Intergenic
1022202215 7:28127591-28127613 CAGAGATAAATGTCAAAAAAAGG + Intronic
1023560491 7:41468541-41468563 CAGAGAAAACAATGAAAAATGGG - Intergenic
1023919997 7:44621402-44621424 AAGAGAGAAAGGTGAAGAATGGG + Intronic
1026068778 7:67099330-67099352 CAGACATAAAGATAAAAATTAGG - Intronic
1026387823 7:69868230-69868252 AAGAGATAAAGCTGAATCCTAGG - Intronic
1026924567 7:74181613-74181635 CAGAGATAGAGCAGAAACAGAGG + Intronic
1027955369 7:84872476-84872498 CAGAGAAAATAGTGAAAAATAGG + Intergenic
1028814341 7:95127380-95127402 CAGAGATCAATGTGAAAAAGAGG - Intronic
1028870414 7:95765498-95765520 TAGAGATCAAGCAGAAAAAGAGG - Intergenic
1028882466 7:95895326-95895348 GAGTGAAAAAGCTGATAAATGGG - Intronic
1029975015 7:104825701-104825723 CAAAAATAAAGCTGGAAACTGGG - Intronic
1030253983 7:107486085-107486107 CAGAGATAAAGCTGAAAAATAGG + Intronic
1030302572 7:107989205-107989227 CAGAAAGAGCGCTGAAAAATAGG + Intronic
1030396172 7:108989155-108989177 CAGAAATAAGGAGGAAAAATGGG + Intergenic
1031553588 7:123144235-123144257 CAGGGATAGAGATAAAAAATTGG + Intronic
1031666333 7:124487911-124487933 CAGAAATAAAGGAGATAAATGGG + Intergenic
1032106763 7:129038205-129038227 GAGAGGTAGAGCTAAAAAATGGG + Intronic
1032187502 7:129739914-129739936 CAGAGCTGCTGCTGAAAAATGGG + Intronic
1033332792 7:140429988-140430010 TAGAGATAAAGCTGTAAGGTTGG + Intergenic
1033501343 7:141953389-141953411 AAGTGAAAAAGCTGAAAATTAGG + Intronic
1033531683 7:142270566-142270588 AAGATATTAAGCTGAGAAATCGG - Intergenic
1033858672 7:145597571-145597593 AAGAAATAAAGATGAAAAAAAGG - Intergenic
1034601712 7:152263812-152263834 CAGAGATAAAGCTGTAGGACAGG - Intronic
1036614896 8:10380627-10380649 GAGACATAAAGATGAAAAAATGG - Intronic
1038011839 8:23482078-23482100 CAGAGATGAAGCTGAGGAAGAGG - Intergenic
1039416802 8:37402059-37402081 CAGTGATAAAACTGAGAGATGGG - Intergenic
1039750833 8:40476946-40476968 CTGAGATAAAGCTGAAAAGATGG + Intergenic
1040054123 8:43042697-43042719 CACATATAAAGTTCAAAAATGGG + Intronic
1040666939 8:49645152-49645174 CAGAGATAGAGCTGATGAAAGGG - Intergenic
1041568012 8:59302800-59302822 GAGAGATAAAGTTAATAAATGGG + Intergenic
1043048211 8:75353664-75353686 CAGCAATAAAACTGAAAAAGTGG + Intergenic
1043526244 8:81099389-81099411 CAGGGACAAAGCTGAGAAACAGG + Intronic
1043856261 8:85268934-85268956 CTGAGATAAAAATGAAAAATGGG + Intronic
1046059037 8:109114433-109114455 GAGAGATACAGCTGCAAAAAGGG - Intronic
1046167619 8:110458164-110458186 CAAAGGTAATGCTGAAAATTAGG + Intergenic
1046569485 8:115945284-115945306 GAAAGATAAAGTTGAAAAAAAGG + Intergenic
1047689062 8:127332028-127332050 AAGGGTCAAAGCTGAAAAATTGG - Intergenic
1050670216 9:7988423-7988445 CATAGAAAAAGCTGGGAAATGGG - Intergenic
1051131912 9:13871902-13871924 CAGAATTAAAACTGAAATATAGG - Intergenic
1051330718 9:16022502-16022524 CAGAGCTGAAGCTGAAGAACAGG - Intronic
1051901797 9:22050945-22050967 CAGTGAAAAAGCTGCAAAAACGG - Intergenic
1051915766 9:22205712-22205734 CAAAAATAAAGCTGAAATTTTGG - Intergenic
1052392563 9:27897922-27897944 CATCTATAAAGTTGAAAAATTGG - Intergenic
1052515434 9:29473124-29473146 CACAGATAAAGAAGAAAACTAGG - Intergenic
1053179231 9:35953992-35954014 CAGAAATAAATGTGAAAATTTGG - Intergenic
1053671891 9:40374370-40374392 CAGGGATGAAACTGAGAAATTGG + Intergenic
1053921703 9:43000732-43000754 CAGGGATGAAACTGAGAAATTGG + Intergenic
1054383006 9:64514418-64514440 CAGGGATGAAACTGAGAAATTGG + Intergenic
1054512729 9:66001940-66001962 CAGGGATGAAACTGAGAAATTGG - Intergenic
1055043820 9:71904347-71904369 TACAGCTAAAGCTGAAAAACGGG - Intronic
1055167684 9:73217568-73217590 CAGGGATGAATCTGAAAAATAGG + Intergenic
1055720050 9:79163283-79163305 CACAGTCAAAGTTGAAAAATTGG + Intergenic
1055861020 9:80748847-80748869 CTGAGATAAGGCCGAAAGATGGG - Intergenic
1057945043 9:99319126-99319148 CAGAGACAAAGGTGAAAAGAAGG - Intergenic
1058987669 9:110223916-110223938 CAAAGATAATCCTGAAAACTAGG + Intergenic
1059282284 9:113145216-113145238 CAGAGGCAAATCTGAAGAATAGG - Intergenic
1059348406 9:113647817-113647839 CACAGAGAAAGGAGAAAAATTGG + Intergenic
1059742750 9:117168923-117168945 TAGAGGCAAAACTGAAAAATAGG - Intronic
1060067164 9:120512774-120512796 CACAGATTAATCTGTAAAATGGG + Intronic
1060206167 9:121684112-121684134 CAGAAAGACAGCTGAAACATGGG - Intronic
1060762540 9:126267975-126267997 CAAAGATAAAACTGAATAAAGGG - Intergenic
1060938358 9:127528836-127528858 CAGGGATGAAGATGAAAACTAGG - Intronic
1060973873 9:127753974-127753996 CAGTGATTAAGCTGGAAAAGGGG - Intronic
1186538480 X:10374201-10374223 CAGAGCCAAAGAGGAAAAATTGG - Intergenic
1187060919 X:15786508-15786530 TAGACATAAAGGTGGAAAATGGG + Exonic
1187350696 X:18514125-18514147 GAGAGATCATGCTGATAAATAGG + Intronic
1188287036 X:28339857-28339879 GGGAGATAAGGCTGATAAATTGG + Intergenic
1188391527 X:29626749-29626771 CAGAGATCCAGCTGAGTAATGGG - Intronic
1189139187 X:38583191-38583213 CAGAATGAAAGCTAAAAAATGGG - Intronic
1189163872 X:38839620-38839642 GGGAGATAAAGCTGGAAAAATGG + Intergenic
1189508909 X:41641555-41641577 GAGAGATAAAGGTGTTAAATAGG + Intronic
1189633297 X:42977396-42977418 CAGAGATTAAGGTAAAAAACTGG - Intergenic
1190493134 X:51002621-51002643 AAGAGACAAAACTGAAAGATAGG + Intergenic
1190511363 X:51177055-51177077 AAGAGACAAAACTGAAAGATAGG - Intergenic
1191613494 X:63142139-63142161 CAGAGATACAGTTAAAAGATAGG + Intergenic
1191622803 X:63236788-63236810 CAGAGATACAGTTAAAAGATAGG - Intergenic
1191670046 X:63740614-63740636 CAAAGCCAAAGCTGAGAAATGGG + Intronic
1192257222 X:69471968-69471990 CAGAGATAGAACTGGAAAATGGG - Intergenic
1193343007 X:80373733-80373755 CAAAGAGAAAACAGAAAAATGGG - Intronic
1193608338 X:83595887-83595909 CAGAAGTCAGGCTGAAAAATTGG - Intergenic
1193690108 X:84631202-84631224 CAGAGAAATAGTTGCAAAATTGG + Intergenic
1194406602 X:93503843-93503865 AAGAGGAAAAGGTGAAAAATGGG + Intergenic
1194438346 X:93897372-93897394 CAGAGATAAAACAGAGAAAATGG - Intergenic
1194449632 X:94028522-94028544 CAGAGATCAAGATCAAATATAGG - Intergenic
1195438605 X:104875011-104875033 CAGTGTTACATCTGAAAAATGGG + Intronic
1195601588 X:106755052-106755074 AATAGATAAAGATGAAAAATGGG + Intronic
1195620983 X:106954724-106954746 CAGTTATAATACTGAAAAATTGG + Intronic
1196484551 X:116190021-116190043 CATAGATGAAGCTGGAAACTGGG - Intergenic
1196624917 X:117867609-117867631 CAGTGGTAAAGCTGAACAACTGG + Intergenic
1196770085 X:119284726-119284748 GAGAGGGAAAGCTGAAAAGTAGG - Intergenic
1197138012 X:123085299-123085321 CTGAGAAAAATCTGGAAAATTGG + Intergenic
1197609203 X:128619989-128620011 CAGAGATAGATCTGAAGAAAAGG - Intergenic
1197614933 X:128680374-128680396 CAGAATTAAAGCTCAAAAAAGGG + Intergenic
1199409775 X:147507983-147508005 CAGAGAAAATGCTGAGAAATTGG + Intergenic
1199889656 X:152064331-152064353 CAGAGATATAGATGGCAAATAGG - Intergenic
1201395671 Y:13545103-13545125 CAGAGATAAAGCAAACAAATGGG + Intergenic