ID: 1030261052

View in Genome Browser
Species Human (GRCh38)
Location 7:107564193-107564215
Sequence GCCCACCTTCTCCTTGGCTA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 173}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030261052 Original CRISPR GCCCACCTTCTCCTTGGCTA GGG (reversed) Exonic