ID: 1030261597

View in Genome Browser
Species Human (GRCh38)
Location 7:107570618-107570640
Sequence CACCTTGTTACAGCCTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030261593_1030261597 7 Left 1030261593 7:107570588-107570610 CCTGGCCTTGGTATCAATAGAAT 0: 1
1: 0
2: 2
3: 11
4: 416
Right 1030261597 7:107570618-107570640 CACCTTGTTACAGCCTTTGGAGG 0: 1
1: 0
2: 0
3: 18
4: 116
1030261594_1030261597 2 Left 1030261594 7:107570593-107570615 CCTTGGTATCAATAGAATGTTGG 0: 1
1: 0
2: 0
3: 13
4: 117
Right 1030261597 7:107570618-107570640 CACCTTGTTACAGCCTTTGGAGG 0: 1
1: 0
2: 0
3: 18
4: 116
1030261592_1030261597 12 Left 1030261592 7:107570583-107570605 CCTTACCTGGCCTTGGTATCAAT 0: 1
1: 0
2: 4
3: 38
4: 360
Right 1030261597 7:107570618-107570640 CACCTTGTTACAGCCTTTGGAGG 0: 1
1: 0
2: 0
3: 18
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030261597 Original CRISPR CACCTTGTTACAGCCTTTGG AGG Intronic
904128392 1:28258836-28258858 CACCTTGTTACAAAGTTTCGAGG + Intergenic
904642726 1:31942549-31942571 AACCATGTTACAGCCTTCTGTGG - Intronic
904976498 1:34460945-34460967 CACCCTGCTGCAGACTTTGGAGG + Intergenic
906815663 1:48875632-48875654 CATCTTGGTTCAGCCTCTGGCGG + Intronic
908696541 1:66848927-66848949 CACCTTGTTACAGCCTAGTGAGG - Intronic
909478504 1:76109518-76109540 CACCTTTCTAAAGGCTTTGGTGG + Intronic
909773160 1:79451484-79451506 AACCTTGTCACATCCTTTTGGGG - Intergenic
914700714 1:150130385-150130407 CACCATGTTACAGCCTAGGCTGG + Intronic
914993079 1:152515409-152515431 CCCCTTGGAAAAGCCTTTGGCGG - Exonic
920246109 1:204588857-204588879 GGCCTTGTTACAGACTTTTGGGG + Intergenic
922412523 1:225390181-225390203 CCCTTTGTCACGGCCTTTGGAGG - Intronic
1063502038 10:6563925-6563947 CACCTTGACACAGCCCGTGGGGG + Intronic
1064121263 10:12622161-12622183 CCCCTTGGTACAGCCTTGTGAGG + Intronic
1066628491 10:37434534-37434556 CACCCTGTTACAGCGGTTTGTGG - Intergenic
1066802761 10:39208593-39208615 CGCTTTGTTACAACATTTGGAGG - Intergenic
1070814564 10:79314615-79314637 GACCTGGTTATAGCCTTTGCTGG + Exonic
1075593949 10:123713823-123713845 CACCTAGTTCCAGCCCTGGGTGG + Intronic
1076271276 10:129154304-129154326 CACCTTGTGAGAGATTTTGGAGG - Intergenic
1078325804 11:10379917-10379939 TACCTTCTTACAGGCTCTGGTGG - Intronic
1080687853 11:34530287-34530309 CTCCCTGCTAGAGCCTTTGGAGG + Intergenic
1081667780 11:44926666-44926688 CACCGTGTAACAGCCCTGGGAGG - Exonic
1081832212 11:46122657-46122679 CTCCATGTTACAGTCCTTGGAGG - Intergenic
1086084561 11:82941709-82941731 CTTCTTGTTACAGACTTTAGAGG - Intronic
1091719228 12:2800558-2800580 CACCTTGTTACAGCTTTCAATGG - Exonic
1096131511 12:49162668-49162690 CACCTTGTTACAGCCTAGCAAGG - Intergenic
1097293623 12:57941371-57941393 CGGGTTGTTACAGCCTTTGAGGG + Intergenic
1097356632 12:58609437-58609459 CAGGTTGTTACTGCTTTTGGGGG + Intronic
1098824254 12:75273047-75273069 CACCTTGTTACATGCTTTGAAGG + Intergenic
1102050122 12:109856072-109856094 TACCATGTTCCAGCCTGTGGGGG - Intronic
1109422999 13:62137899-62137921 CACAGTGTTACAGCCTTTCTAGG - Intergenic
1111063020 13:83047968-83047990 CACCTTGTTGCATCCTCTGGAGG - Intergenic
1114551975 14:23537913-23537935 CACCTGTGTACAGCCCTTGGCGG - Intronic
1118968702 14:70613036-70613058 CACCTTGTAATTGCCTGTGGAGG + Intergenic
1122195900 14:100085608-100085630 CATCTTGTGGCAGCCTTTGTGGG + Intronic
1124191070 15:27576701-27576723 CAGATTGACACAGCCTTTGGAGG - Intergenic
1124247861 15:28085990-28086012 CACTGTGTAATAGCCTTTGGAGG - Intronic
1124659208 15:31531717-31531739 CACCTTGTTACAGCCTGGTGAGG - Intronic
1124925206 15:34063895-34063917 CACCTTGTGACAGCCATTGTTGG - Exonic
1127046297 15:55029102-55029124 CAGCTGGTTACAGCATTTGATGG + Intergenic
1127050750 15:55081108-55081130 CACCTTATTACAGCCTTGTGAGG - Intergenic
1128531632 15:68454160-68454182 TACCTTGTAACAGATTTTGGAGG - Intergenic
1130368676 15:83264066-83264088 CACCATGTTACACCCTTCGATGG + Exonic
1131391866 15:92056209-92056231 CACATTTGTTCAGCCTTTGGGGG + Intronic
1132811949 16:1804308-1804330 CCCCTTGTTCCTGCCTTTAGAGG + Intronic
1133008266 16:2896589-2896611 CACCTTGGTGCTGTCTTTGGAGG - Exonic
1139952287 16:70678251-70678273 CACCTTCCTGCAGCCTGTGGTGG - Exonic
1141532341 16:84655173-84655195 CACATTCTCACAGCCTGTGGAGG - Intronic
1142234763 16:88916769-88916791 CTCCTTGCTACAGCCCCTGGGGG + Intronic
1143525213 17:7467921-7467943 CAGCTTGCTCCAGCCTCTGGAGG + Intronic
1143869885 17:9950568-9950590 CACCTTGTGGCAGCGTGTGGTGG + Intronic
1151448187 17:74180938-74180960 CACCCTGTCAGTGCCTTTGGTGG + Intergenic
1151897179 17:76988296-76988318 CACCTTGTCACAGTCGGTGGGGG + Intergenic
1156020008 18:32588962-32588984 CTCCATGTTACAGCCTTGTGTGG - Intergenic
1158240082 18:55367782-55367804 CACATTTTTACAGCTTTTGTGGG - Intronic
1163027523 19:14521112-14521134 AGCCATGTTAAAGCCTTTGGAGG - Intronic
1164489091 19:28690392-28690414 TACCTGGTTACAGCCTTCAGAGG - Intergenic
1165272402 19:34722474-34722496 CGCCTGGTTACAACATTTGGAGG + Intergenic
1165664862 19:37619550-37619572 CACCTTGTTACAGCCTATAAAGG - Intronic
1166999817 19:46739162-46739184 CACCTGGTGGCTGCCTTTGGGGG + Intronic
925019232 2:555466-555488 CCTCTTGTCACAGCCTGTGGGGG + Intergenic
926516595 2:13853958-13853980 TACATTATTACAGACTTTGGTGG + Intergenic
926628682 2:15117603-15117625 GACCTTCTCAGAGCCTTTGGTGG + Intergenic
927441658 2:23122952-23122974 GACCTTTTTCCAGCCTTTTGTGG + Intergenic
928300827 2:30122394-30122416 CACCTTGATACAGCCTGGTGAGG - Intergenic
931214258 2:60226591-60226613 TTGCTTCTTACAGCCTTTGGTGG + Intergenic
935412532 2:102780738-102780760 CACCTTGTTACAAACTGTGGAGG + Intronic
938390297 2:130899596-130899618 CACCTGCTTAGAGTCTTTGGCGG - Intronic
940132158 2:150394304-150394326 GACTTTGTTCCTGCCTTTGGGGG + Intergenic
943992498 2:194714601-194714623 CACCTTGATGCAGCATTTTGAGG + Intergenic
948452375 2:238084116-238084138 TACCTTGTTACAGCCTGTATTGG - Intronic
1172201721 20:33131729-33131751 CATATTTCTACAGCCTTTGGAGG - Intergenic
1174803601 20:53586171-53586193 CACCTTGTTCCAGGCATTGGGGG - Intronic
1174919358 20:54685304-54685326 CTCCTTGCTACAGCCACTGGTGG + Intergenic
1176117946 20:63441231-63441253 CCCTTTCTTGCAGCCTTTGGGGG - Intronic
1177510216 21:22076700-22076722 AACTTTGTTACGGCCTTTGTAGG - Intergenic
1180560426 22:16610640-16610662 CACCTTGTTCCAGGCATTGGGGG + Intergenic
1181838975 22:25638115-25638137 GACCTTGTTATCGCCTTTAGTGG - Intronic
1183534585 22:38390547-38390569 CACCTTGTTCCAGGCATTGGGGG - Intronic
1184588197 22:45462014-45462036 CACCTCATTACAGCCTCTCGTGG - Intergenic
1185132577 22:49047642-49047664 CCCTGTGTAACAGCCTTTGGAGG + Intergenic
951436991 3:22676476-22676498 CACCATATTCCAGCCTGTGGTGG - Intergenic
953388235 3:42519214-42519236 CATCTTGCTGCAGCCTATGGGGG - Exonic
956126839 3:66018640-66018662 GGACTTGGTACAGCCTTTGGTGG + Intronic
956393662 3:68801356-68801378 AATTTTGCTACAGCCTTTGGGGG + Intronic
957883518 3:86253605-86253627 CACATTTTTACATCCTTTTGGGG + Intergenic
960059860 3:113310057-113310079 CACCTCGTTACAGCCCTGTGAGG - Intronic
962080291 3:132131649-132131671 CACAATGTTCCCGCCTTTGGAGG - Intronic
963217156 3:142761155-142761177 CATCTTGTTCCAGTCTTTAGAGG + Intronic
968557572 4:1254570-1254592 CACCTTTTGAAGGCCTTTGGTGG - Intergenic
968624653 4:1621683-1621705 GACCTTGTGACAGCCTTGGATGG - Intronic
970568766 4:17358748-17358770 CACCTTGTGAGAGCTCTTGGAGG - Intergenic
972738027 4:41864621-41864643 TACCTTGCAACAGCCTTTGGAGG + Intergenic
981856215 4:149296179-149296201 CTTCTTTTTCCAGCCTTTGGAGG + Intergenic
981936183 4:150242392-150242414 CACCTAGTTAATGACTTTGGTGG - Intronic
993773377 5:91960803-91960825 CATCTTGTTACAGACTTTTCTGG - Intergenic
999162997 5:149521236-149521258 CAAATTGTTACAGCCTATTGTGG - Intronic
1001481186 5:172090193-172090215 CACCCTGTTACCACCATTGGTGG + Intronic
1003347481 6:5284152-5284174 CACCTTGTTACAGCTTTCAGAGG + Intronic
1003957670 6:11179252-11179274 CCCCTTGCAACAGCATTTGGAGG + Intergenic
1006265745 6:32921776-32921798 CACCTTGTTACAGCTTCAAGAGG - Intergenic
1006784931 6:36660202-36660224 CACCTTTTGACAGGTTTTGGGGG + Intergenic
1007539048 6:42624005-42624027 TTCCTTGTTATAGCCTTTTGGGG + Intronic
1008357208 6:50568681-50568703 CCCCTTGTTACAGCCGTTTGAGG - Intergenic
1008430897 6:51415442-51415464 CACCTAGTTACAGCCTATGAGGG + Intergenic
1013836629 6:114342525-114342547 CACCTGGTTCCAGCCTCTCGGGG - Exonic
1015417855 6:132970086-132970108 CAGCTTGTGAGCGCCTTTGGTGG + Intergenic
1019908539 7:4083422-4083444 CACCTGGTTACATCCTTGTGGGG + Intronic
1020566734 7:9807272-9807294 CACCTTGTTTCATCATTTGATGG - Intergenic
1022102975 7:27180134-27180156 CACATTGTCACAGCCATCGGAGG + Intronic
1022642034 7:32196189-32196211 TACCTTGTTACAGCCTTGTGAGG + Intronic
1022903608 7:34834597-34834619 CCGCCTGTGACAGCCTTTGGTGG - Intronic
1028953904 7:96667258-96667280 GACCAAATTACAGCCTTTGGCGG + Intronic
1030261597 7:107570618-107570640 CACCTTGTTACAGCCTTTGGAGG + Intronic
1034414260 7:150956512-150956534 CACCTTATCCTAGCCTTTGGGGG - Intronic
1035763563 8:2087172-2087194 ACCCTAGTTACAGCCTTTGTAGG - Intronic
1038533678 8:28338706-28338728 CACCTTGTTACATCTTTAGTCGG - Intronic
1041768737 8:61449473-61449495 CATCTTGTTACAGCCTTGCTAGG + Intronic
1045108992 8:98921574-98921596 CAAGTTGTTACAGCCTATGATGG + Intronic
1045520897 8:102902102-102902124 CACCTGGTTACAGCCACTGTGGG + Intronic
1047666094 8:127092593-127092615 CACCTTGTCACAGGATTTGGGGG - Intergenic
1051962292 9:22781468-22781490 CTTCTTGTTTCAGCCTTAGGAGG + Intergenic
1052180735 9:25524326-25524348 CACATTGTCACAGGTTTTGGTGG + Intergenic
1052861837 9:33442322-33442344 CGCCTTTTTACAGCCCTTGCGGG - Exonic
1057066691 9:92059837-92059859 CGCCTTGTTACAGCCTCTCGAGG - Intronic
1062053315 9:134458275-134458297 CACCTTGGTCAAGCCTCTGGTGG + Intergenic
1186177732 X:6942889-6942911 CTCCTTCTTAGAGCCTTTAGAGG + Intergenic
1186513372 X:10148108-10148130 TACCTTTTTTCAGACTTTGGTGG + Intergenic
1194730493 X:97447674-97447696 CAACATTTTACAGCCTGTGGAGG - Intronic
1195466790 X:105188302-105188324 AACCCTGTTACAGGGTTTGGTGG + Intronic
1195481939 X:105355150-105355172 CTCCTTGTAAAATCCTTTGGTGG + Intronic
1196202830 X:112905478-112905500 CACCTTTTTTCTGCCTTTTGTGG - Intergenic
1196313093 X:114191199-114191221 CACCTTTTTTCTGCCTTTTGTGG - Intergenic
1198319379 X:135504698-135504720 CACCTTTTTACAGCCTGTTAAGG + Intergenic
1200008860 X:153106856-153106878 CAGCTCGTTACTGCCTGTGGTGG - Intergenic
1200030740 X:153293066-153293088 CAGCTCGTTACTGCCTGTGGTGG + Intergenic