ID: 1030262484

View in Genome Browser
Species Human (GRCh38)
Location 7:107580257-107580279
Sequence CGGCGGCCGCGGAGCAGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 362}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030262466_1030262484 26 Left 1030262466 7:107580208-107580230 CCCTGGCTCCCCTCCCCCGCCCA 0: 1
1: 0
2: 9
3: 116
4: 1166
Right 1030262484 7:107580257-107580279 CGGCGGCCGCGGAGCAGCGCAGG 0: 1
1: 0
2: 4
3: 48
4: 362
1030262471_1030262484 16 Left 1030262471 7:107580218-107580240 CCTCCCCCGCCCAGCCGCGGCGT 0: 1
1: 0
2: 4
3: 60
4: 3801
Right 1030262484 7:107580257-107580279 CGGCGGCCGCGGAGCAGCGCAGG 0: 1
1: 0
2: 4
3: 48
4: 362
1030262474_1030262484 11 Left 1030262474 7:107580223-107580245 CCCGCCCAGCCGCGGCGTCTGAC 0: 1
1: 0
2: 0
3: 9
4: 158
Right 1030262484 7:107580257-107580279 CGGCGGCCGCGGAGCAGCGCAGG 0: 1
1: 0
2: 4
3: 48
4: 362
1030262469_1030262484 18 Left 1030262469 7:107580216-107580238 CCCCTCCCCCGCCCAGCCGCGGC 0: 1
1: 0
2: 12
3: 115
4: 1012
Right 1030262484 7:107580257-107580279 CGGCGGCCGCGGAGCAGCGCAGG 0: 1
1: 0
2: 4
3: 48
4: 362
1030262477_1030262484 6 Left 1030262477 7:107580228-107580250 CCAGCCGCGGCGTCTGACGTCCC 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1030262484 7:107580257-107580279 CGGCGGCCGCGGAGCAGCGCAGG 0: 1
1: 0
2: 4
3: 48
4: 362
1030262478_1030262484 2 Left 1030262478 7:107580232-107580254 CCGCGGCGTCTGACGTCCCGCGC 0: 1
1: 0
2: 0
3: 4
4: 37
Right 1030262484 7:107580257-107580279 CGGCGGCCGCGGAGCAGCGCAGG 0: 1
1: 0
2: 4
3: 48
4: 362
1030262470_1030262484 17 Left 1030262470 7:107580217-107580239 CCCTCCCCCGCCCAGCCGCGGCG 0: 1
1: 0
2: 4
3: 57
4: 535
Right 1030262484 7:107580257-107580279 CGGCGGCCGCGGAGCAGCGCAGG 0: 1
1: 0
2: 4
3: 48
4: 362
1030262467_1030262484 25 Left 1030262467 7:107580209-107580231 CCTGGCTCCCCTCCCCCGCCCAG 0: 1
1: 0
2: 15
3: 170
4: 1293
Right 1030262484 7:107580257-107580279 CGGCGGCCGCGGAGCAGCGCAGG 0: 1
1: 0
2: 4
3: 48
4: 362
1030262476_1030262484 7 Left 1030262476 7:107580227-107580249 CCCAGCCGCGGCGTCTGACGTCC 0: 1
1: 0
2: 0
3: 4
4: 34
Right 1030262484 7:107580257-107580279 CGGCGGCCGCGGAGCAGCGCAGG 0: 1
1: 0
2: 4
3: 48
4: 362
1030262475_1030262484 10 Left 1030262475 7:107580224-107580246 CCGCCCAGCCGCGGCGTCTGACG 0: 1
1: 0
2: 0
3: 2
4: 134
Right 1030262484 7:107580257-107580279 CGGCGGCCGCGGAGCAGCGCAGG 0: 1
1: 0
2: 4
3: 48
4: 362
1030262472_1030262484 13 Left 1030262472 7:107580221-107580243 CCCCCGCCCAGCCGCGGCGTCTG 0: 1
1: 0
2: 0
3: 139
4: 1452
Right 1030262484 7:107580257-107580279 CGGCGGCCGCGGAGCAGCGCAGG 0: 1
1: 0
2: 4
3: 48
4: 362
1030262473_1030262484 12 Left 1030262473 7:107580222-107580244 CCCCGCCCAGCCGCGGCGTCTGA 0: 1
1: 0
2: 3
3: 4
4: 165
Right 1030262484 7:107580257-107580279 CGGCGGCCGCGGAGCAGCGCAGG 0: 1
1: 0
2: 4
3: 48
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030262484 Original CRISPR CGGCGGCCGCGGAGCAGCGC AGG Intronic
900109214 1:998576-998598 AGGCGGTCGCGCAGCATCGCCGG - Intergenic
900117328 1:1034205-1034227 CGGAGCCCCCGGAGCCGCGCAGG - Intronic
900130313 1:1084619-1084641 CGGCGTCCTCGGAGCAGCAGAGG + Intronic
900154592 1:1198869-1198891 CCGTGGCTGCGGAGCAGGGCAGG - Intergenic
900171993 1:1273795-1273817 CGGCGGCGGCGGCGCTGCGGCGG - Exonic
900240917 1:1616840-1616862 CGGCCGCAGCGCAGGAGCGCCGG + Intronic
900786758 1:4654620-4654642 GGGAGGCGGCTGAGCAGCGCGGG + Intergenic
902783126 1:18717029-18717051 CGGCGGCGGCGGCGGAGCGCGGG - Intronic
902823233 1:18956221-18956243 CGGCGGCGGCGGGGCAGGGCCGG - Exonic
903263430 1:22143142-22143164 CGGCGGCGGCGGAGGCGGGCGGG + Intronic
903324834 1:22563735-22563757 CGGCGGCGGCGGGGCGGGGCAGG + Intronic
903822114 1:26111177-26111199 CGGCGGCGGCGGCGCGGGGCTGG - Intronic
903907414 1:26696525-26696547 CGGCGGCAGCGGCCGAGCGCGGG + Exonic
904541989 1:31239583-31239605 CGGCGGCCGCGGAGCAAGAAGGG - Intergenic
904618919 1:31764046-31764068 AAGGCGCCGCGGAGCAGCGCGGG + Intronic
904696776 1:32335690-32335712 GGGCGGCCGGGGGGCAGCGCCGG + Intronic
904724978 1:32539949-32539971 CGGCCGCCGCGGGGGCGCGCGGG + Intronic
905449324 1:38046756-38046778 CGGCGGCGGCGGCGCGGCGCAGG - Exonic
905647212 1:39633050-39633072 CGGCGGCGGCGGGGCTGGGCCGG + Intronic
905863858 1:41366440-41366462 CGGCGGCGGGGGAGGGGCGCCGG - Intronic
906508028 1:46394419-46394441 CGGCGGCCGTGGCCCTGCGCTGG + Exonic
906636947 1:47416275-47416297 CTGCGGTCCCGGAGCCGCGCGGG + Exonic
907118756 1:51990713-51990735 CGGCCGGAGCGGAGCAGTGCTGG - Exonic
908355481 1:63322655-63322677 CGCCGGGCGCCGAGCAGCTCGGG - Intergenic
908714285 1:67053743-67053765 CGGCGGCGGCGGCGCGGCGCCGG - Intronic
912408920 1:109466612-109466634 CGGCCGCCGCGGTGCCCCGCCGG - Exonic
912492622 1:110070473-110070495 CGCGGGCCGCGGGGCGGCGCGGG + Exonic
912576364 1:110675325-110675347 CGGCGCCCGCGGGGCCGCGGCGG - Intergenic
913300876 1:117367402-117367424 CGGCGGCCACTGAGAAGCCCCGG - Intergenic
914242274 1:145859792-145859814 CGGCGGCCGCGGCTCCGCCCGGG + Intronic
914243899 1:145872129-145872151 CGGTGGCCGAGGAGCGCCGCCGG - Exonic
915934783 1:160084073-160084095 TGGCGGCCGCGGCGCCGCGGCGG - Exonic
916651693 1:166839688-166839710 CGGCGGCGGCGGCGCAGCCTCGG - Intronic
918015951 1:180632457-180632479 CGGCGGCAGCGGGGCTGCGGGGG - Intronic
920260541 1:204685273-204685295 CGGCGGCGGCGGCGCTGCCCAGG + Intronic
921029718 1:211326801-211326823 CGGCGGCGGCGGCGAAGCGGAGG - Intronic
921604759 1:217139699-217139721 CGGCGGCGGCGGCGGTGCGCGGG + Intergenic
922250574 1:223845794-223845816 CGGCGGCAGCGGCGGCGCGCGGG + Exonic
922677359 1:227561067-227561089 CGGCCGCCGGCGAGCAGCTCAGG + Intergenic
922753533 1:228082154-228082176 CGGCGGCCGCAGTGACGCGCGGG - Intergenic
922929062 1:229374688-229374710 CGGAGGCCACGGTGCAGCACAGG + Intergenic
924801236 1:247331041-247331063 AGGGGGCCGCCGAGCAGGGCGGG - Intronic
1065099926 10:22321960-22321982 TGGCGGCGGCGGCGCGGCGCGGG - Intronic
1065188611 10:23191983-23192005 CCGCGCGCGCTGAGCAGCGCCGG - Intergenic
1065188871 10:23192964-23192986 CGGCTGCGGCGGCGCGGCGCCGG + Exonic
1065573976 10:27100253-27100275 CGGCGGCAGAGGAGCAGCGCGGG - Exonic
1066080709 10:31928527-31928549 CGGCGGCGGCGGCGCCGCGGAGG - Intronic
1067090228 10:43262674-43262696 CGGCTGCTGCAGAGCAGCCCCGG + Intronic
1071546780 10:86535617-86535639 GGGCGGCTGCGGCGCAGCTCTGG - Intergenic
1073049188 10:100656690-100656712 CGGCGGGCGGGGCGCAGCGGCGG + Intergenic
1074503353 10:114044999-114045021 CGGCGGCGGCGGCGGGGCGCGGG - Exonic
1076064804 10:127440729-127440751 CACAGGCCGCAGAGCAGCGCTGG - Intronic
1076378802 10:130011174-130011196 TGGCGGCCATGGAGCAGCGGTGG - Intergenic
1076834934 10:133016302-133016324 CGGAGGCCCCGGCTCAGCGCCGG - Intergenic
1076916052 10:133423585-133423607 GGGCGGCCGCGGAGGTGCGCGGG - Exonic
1077028104 11:450649-450671 GGGCGGCCGCGGGGCGGCGAGGG + Intronic
1078498257 11:11841995-11842017 CGGCGGCGGCGGCGGAGCCCTGG + Exonic
1079128573 11:17735084-17735106 CGGCGGTCGCGGAGCTGCACGGG - Exonic
1079308529 11:19345229-19345251 CGGCCGCGGCTGAGAAGCGCGGG + Intergenic
1081831504 11:46119963-46119985 CGGCGGCCGCGGGGCGCCCCCGG - Intronic
1083824136 11:65188704-65188726 TGGCGGCGGGGGAGCACCGCGGG + Exonic
1084264498 11:67997876-67997898 CGCAGGCCGCGGAGGAGCGGTGG + Intronic
1084774987 11:71369174-71369196 CGGAGGCCAGGGAGCAGGGCAGG + Intergenic
1086993476 11:93330751-93330773 GGGCGAGCGCGGCGCAGCGCAGG + Exonic
1089694909 11:120211040-120211062 CCGGGGCCGCGGAGCCGGGCCGG + Exonic
1089993443 11:122882946-122882968 TCGCGGCCGCGGAGGAGCGCCGG + Exonic
1090238209 11:125164819-125164841 CGGCGGCGGCGGCGCGGCGGCGG + Intronic
1091563299 12:1630273-1630295 CGGGGGCCCCGGAGGACCGCGGG + Intronic
1091567878 12:1661835-1661857 CGGCGGACTCGGAGCGGGGCAGG + Intergenic
1091616228 12:2053046-2053068 CGGCGGGCCCGGAGCGGCGGCGG + Intronic
1092502606 12:9064352-9064374 CAGCGGCGGCGGAGCAGCTGCGG + Intergenic
1094470280 12:30796239-30796261 CTGCGGCCGCGGGGCGGCGGGGG - Intergenic
1094725203 12:33107587-33107609 CGGTGGCTGCAGAGCAGCGGTGG + Intergenic
1095752792 12:45729657-45729679 CGGCGGCGGCGGCGCAGGGAGGG - Exonic
1096682806 12:53268228-53268250 CAGCGGGCGCGGCGCAACGCCGG - Intergenic
1096786055 12:54017988-54018010 CGCCGGCCGCCTAGCTGCGCCGG - Intronic
1097040327 12:56152536-56152558 CGGTGGCCGCGGAGCATGCCGGG - Exonic
1097264689 12:57738364-57738386 CGGCGACAGCGGAGCCGGGCCGG - Intronic
1098057392 12:66522380-66522402 CGGTGGCCGCAGAACAGCGGTGG - Intronic
1098550376 12:71755147-71755169 CGGCGGCGGCGGGGCGGCGGCGG + Exonic
1102009025 12:109606773-109606795 GGGCTGCCGGGGAGCAGAGCGGG - Intergenic
1102039875 12:109794017-109794039 CGGCGGCTGGGGAGCAGCAAGGG + Exonic
1102197158 12:111033979-111034001 CGGCGGCGGCGGCGCGGCGGCGG + Intergenic
1102350044 12:112185219-112185241 CGGCGGCCGGTGACCAGGGCAGG - Exonic
1102853920 12:116277382-116277404 CGGCGGCTGAGGAGCAGGGAAGG - Intergenic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1103377553 12:120469059-120469081 AAGCGGCCGCGGGGCAGCGCGGG - Intronic
1104678466 12:130731845-130731867 CAGGGGCCACGGAGCAGAGCAGG + Intergenic
1105578023 13:21670970-21670992 CGCCTGCCGCAGAGCGGCGCGGG + Intergenic
1105745727 13:23375527-23375549 CGGCGGCCGAGGAGCAGGCGGGG + Intronic
1106512384 13:30422360-30422382 CCGCGGCCAGGGAGCTGCGCTGG - Intergenic
1106517162 13:30465389-30465411 CCGCCGCCGCCGAGCCGCGCCGG + Intronic
1110558510 13:76886251-76886273 CGGCGGCGGCGGCGGGGCGCAGG - Exonic
1110630035 13:77697636-77697658 CCGCGGCCCCGGAGCGGGGCGGG - Intergenic
1113656165 13:112068737-112068759 CAGCGGCCGCGGCGCAGAGCCGG + Exonic
1114046492 14:18880720-18880742 AAGCGCCCGCGGAGCAGAGCAGG - Intergenic
1114117720 14:19638730-19638752 AAGCGCCCGCGGAGCAGAGCAGG + Intergenic
1114178350 14:20343651-20343673 CGGCGGCGACGGAGCACCGGCGG + Exonic
1115754657 14:36519243-36519265 CGGCGGCCTCGGGGCTCCGCTGG - Exonic
1116657971 14:47674991-47675013 CGGCGGCGGCGGCGGCGCGCTGG + Intergenic
1116887051 14:50231664-50231686 CGGCGGGCGGTGAGCAGCGGCGG + Intergenic
1118317943 14:64737145-64737167 CAGGGGCCACAGAGCAGCGCAGG - Intronic
1121355140 14:93207539-93207561 CGGCGGCCCCGGACCACCACTGG - Intronic
1121535990 14:94691039-94691061 GGACGGCGGCCGAGCAGCGCAGG - Intergenic
1122081690 14:99271290-99271312 CGGCGGCAGCGGCGCGGCGGCGG - Intronic
1122145108 14:99684262-99684284 CGGCGGGGGCGGAGCCGAGCGGG + Intergenic
1122183493 14:99971981-99972003 CGGCGGCGGCGGCGGGGCGCGGG - Intronic
1122418212 14:101560484-101560506 CAGCGGGCGCGGGGCGGCGCCGG - Intergenic
1122418402 14:101561074-101561096 CGGCGGCCGCCGAGCCGCGCCGG - Intergenic
1122445021 14:101761796-101761818 CGGCGGCCGCGGGGGCGCGACGG + Exonic
1122543421 14:102509872-102509894 CGGCGGGCGGGGCGCACCGCTGG + Intergenic
1122745924 14:103897190-103897212 CGGTGGCCACGGAGCAGCCAGGG + Intergenic
1122975290 14:105168436-105168458 CGGCGGCGGCGGGGCCGGGCGGG - Exonic
1123024922 14:105420005-105420027 CGGCGGCGGCGGAGGGGCCCGGG - Exonic
1123041103 14:105490558-105490580 CCGCCGCCACGGAGCAGCCCCGG - Intronic
1123774188 15:23562095-23562117 CTGGGCGCGCGGAGCAGCGCTGG - Intergenic
1124109350 15:26772583-26772605 CCGCATCCGCGGAGCAGCGGCGG - Intronic
1124743136 15:32315379-32315401 GGGCGGCCTCGGGGCCGCGCCGG - Intergenic
1124922396 15:34039195-34039217 CGGCCGCAGCGGAGCGGGGCGGG + Intronic
1124957222 15:34367311-34367333 CGGCGGGCGCGGAGGAGCAGGGG - Intergenic
1125200755 15:37099075-37099097 CGGCGGCAGCGGCGCAGCAGCGG + Intronic
1127439018 15:58987702-58987724 CGGCGGCGGCGGCGAAGCGGCGG + Intronic
1127439019 15:58987705-58987727 CGGCGGCGGCGAAGCGGCGGCGG + Intronic
1127606317 15:60591842-60591864 CGGCGGCCGCTGAGGCGCTCGGG + Intronic
1128841468 15:70854229-70854251 CGGCGGCGGCGGCGCGGGGCGGG - Intronic
1129535580 15:76311356-76311378 CGGCGGCTCCGGGGCAGCTCCGG - Exonic
1131735475 15:95326962-95326984 CGGCGGCTGCGGCGCTCCGCGGG + Intergenic
1132365124 15:101251562-101251584 CGGCGGCGGCGGCGCTGCCCGGG - Exonic
1132498838 16:275877-275899 GGGCGGCCGGGGGGCGGCGCGGG + Exonic
1132585951 16:705816-705838 CGGCGGCCACGGAGGAGCGCGGG - Exonic
1132741310 16:1414650-1414672 CGGCGGCAGCGGCGCTGAGCGGG - Exonic
1132816032 16:1826999-1827021 CGGCGGCCCGAGAGCTGCGCCGG + Exonic
1132934496 16:2473911-2473933 CGGCGGCCGGGGAGCAGGCGCGG - Exonic
1132987874 16:2777358-2777380 CGGCGGCTGCGGGGCGGCACGGG - Intergenic
1133346935 16:5077554-5077576 CGGCGGCCTGGGAGAGGCGCGGG + Intronic
1134172081 16:11976762-11976784 CAGCGGCGGCGGCGCGGCGCAGG + Exonic
1134849743 16:17470478-17470500 AGGCGGCCCCGGAGAACCGCGGG - Exonic
1135023809 16:18984033-18984055 CGGCAGCCTCTGAGGAGCGCGGG + Exonic
1135040602 16:19114424-19114446 CGGCGGTGGCCGAGCAGCCCAGG - Exonic
1135190241 16:20348619-20348641 GGGCGGCCGTGTTGCAGCGCAGG + Exonic
1140223113 16:73058195-73058217 CGGCGGCGGCGGCGCGGGGCCGG + Intronic
1140354883 16:74297059-74297081 CGGCGGCCGCGGACGAGCTGGGG + Intronic
1141418851 16:83898980-83899002 CGGCGGGGGCGGAGCGGCTCTGG - Intergenic
1141694505 16:85613288-85613310 CTGCCGCCGCCGAGCAGCCCCGG + Exonic
1142106204 16:88304248-88304270 GGGCGGCCGGGCTGCAGCGCTGG - Intergenic
1142188456 16:88706079-88706101 CGGCCGCCCCGGTGCAGCTCCGG - Intronic
1142374871 16:89701649-89701671 CGGCCGCCGCGGATCAGTTCGGG + Exonic
1142376801 16:89710803-89710825 CTGGGGCCGCGGGGCTGCGCTGG + Exonic
1142421447 16:89972840-89972862 CGCCGGCCGCGGGGGAGCGCGGG + Intergenic
1142698987 17:1648472-1648494 CGGAGGCCGCGCAGCAGCTCGGG - Exonic
1143527217 17:7479586-7479608 CGGCGGCAGCGGGGCCGGGCCGG - Intronic
1143830386 17:9645904-9645926 CGGCGGCCGCGCCCCATCGCCGG - Exonic
1144565123 17:16353395-16353417 CTGCGGCCGCCAAGCTGCGCGGG - Exonic
1144656948 17:17042803-17042825 CGGCGGCGGCGGCGCAGGCCTGG - Exonic
1144775695 17:17783571-17783593 AGGGGGACGGGGAGCAGCGCAGG - Intronic
1144862556 17:18314794-18314816 CGGCAGCCGGGGAGCGGCTCCGG - Exonic
1146912525 17:36657899-36657921 CGGCCGCCGCCGAGCAGCCGCGG - Intergenic
1146935109 17:36808356-36808378 CAGCGGCCGGGGAGCCGGGCGGG + Intergenic
1148233060 17:45949279-45949301 CGACGGCCGTGGAGCGGCCCCGG - Intronic
1148838873 17:50482137-50482159 CAGCGTCCGCAGAGCATCGCAGG - Exonic
1148936228 17:51166399-51166421 CGGCGGCGGAGGAGGGGCGCAGG - Intronic
1149685395 17:58531919-58531941 GGGCGGGCGCGGGGCAGGGCTGG - Intronic
1152225405 17:79090467-79090489 CAGCGGCGGCGGAGCAGGCCCGG - Intronic
1152544006 17:80991854-80991876 CGGTGGCCGCGGGGCGGCGGTGG + Exonic
1152544114 17:80992177-80992199 CGGCAGCCACGGCGCCGCGCAGG - Intronic
1152628650 17:81399799-81399821 CGGCGGCAGCGGCGCTGCGGTGG - Exonic
1152689619 17:81712136-81712158 AGGCGGCCACGCAGCAGCCCCGG + Intergenic
1152722086 17:81928157-81928179 CGGGGGTCCCGGAGCGGCGCGGG + Intergenic
1152751808 17:82065744-82065766 CGGCGGCCCCGGCGCGGTGCGGG - Intronic
1152817784 17:82418492-82418514 AGGCCGCCGCGGAGCCGGGCCGG + Exonic
1152864904 17:82716726-82716748 CCGCGGCCGCGGACCCGCCCCGG - Exonic
1153688092 18:7566840-7566862 CCGCAGCCGCCGAGCAGCGCAGG + Exonic
1154132892 18:11751651-11751673 AGGCGGCCGCGGCGCAGCGGAGG + Intronic
1156008431 18:32470448-32470470 TGGCGGCGGCGGGGGAGCGCGGG - Intronic
1156099744 18:33578740-33578762 CCGCCGCCGCGGACCGGCGCGGG - Intronic
1157386143 18:47261170-47261192 CGGCGGCGGCTGATCCGCGCAGG - Intergenic
1157614011 18:48976192-48976214 CGGCGGCGGCAGAGGAGCGCAGG + Intergenic
1158478862 18:57803332-57803354 CCGCGGCCGCCGAGCCTCGCTGG + Intergenic
1160025043 18:75209567-75209589 CGCCGGCCGCCGCGCAGCTCCGG - Intergenic
1160557953 18:79738232-79738254 GGACGGCCTCGGAGCAGCCCCGG - Intronic
1160706309 19:531790-531812 CGGCGGCGGCGGCGCAGAGGAGG + Exonic
1160847763 19:1173947-1173969 CGGTGGTCGCGGGGCAGCGCGGG + Intronic
1160991797 19:1863212-1863234 CGGCGGACCCGGAGCCGCCCCGG - Exonic
1161072683 19:2270489-2270511 CGGCCCCCGCGGAGAAGCCCTGG - Intronic
1161086371 19:2337475-2337497 GGTCGGCTGCGGAGCAGAGCAGG - Exonic
1161299821 19:3537264-3537286 CGGGGGCCACTCAGCAGCGCTGG + Intronic
1161428599 19:4217766-4217788 CGGCGGCCGCGGAACTGGGCCGG + Exonic
1161802720 19:6424753-6424775 CGGCGGCGGCGGCTCAACGCGGG + Exonic
1162046819 19:8005515-8005537 CGCCCGCCCCGGAGCAGCCCCGG - Exonic
1162445122 19:10718193-10718215 CGGCGGCGGGCGAGGAGCGCAGG + Exonic
1162778667 19:12995669-12995691 CGGCGAGCGCGGAGCGGCGCCGG + Exonic
1162914120 19:13865318-13865340 CGGCGGCTCCGGGGCAGGGCGGG - Intronic
1163167599 19:15508617-15508639 GCGCGGCCGCGGCGCTGCGCTGG + Intronic
1166042864 19:40213849-40213871 CGGCGGCCGTGGGGACGCGCGGG - Exonic
1166100834 19:40570553-40570575 CGGCGGCCGCGGCCCAGAGAGGG + Exonic
1166533203 19:43554685-43554707 GGGCAGCCGCCGAGAAGCGCTGG - Exonic
1166888066 19:45973478-45973500 CGGCGGCTGCGGGGCCGCGGAGG + Exonic
1167286958 19:48603703-48603725 CGGGGGCCACGGAGCGGCGGCGG + Exonic
1167369651 19:49072825-49072847 CGGCGGCGGCGGGGCAGGGCAGG - Exonic
1168297351 19:55383878-55383900 CGGCGGGCGCCGACCAGCGGCGG + Exonic
1168528374 19:57106408-57106430 CGGCGGCGGCCGAGCTGCGCGGG + Intergenic
925183649 2:1832645-1832667 TGGTGGCCGCGGAGGAGAGCTGG - Intronic
925925434 2:8666790-8666812 CGGGGGCCGAGGACCAGGGCTGG - Intergenic
926285217 2:11482697-11482719 GGACGGCCGCGGAGGAGGGCCGG - Intergenic
926980212 2:18560389-18560411 CGGCGGCCGTGGCGCGGCCCAGG + Exonic
927982174 2:27380904-27380926 AGCCGGCCAGGGAGCAGCGCAGG + Intergenic
928793838 2:34992082-34992104 CGGCGCTCGCGGGCCAGCGCGGG + Intergenic
929452819 2:42048151-42048173 CCGGGGCCGGGGAGCCGCGCGGG + Exonic
931392290 2:61854442-61854464 CGGCGGCGGCGGAGGAAAGCAGG + Intergenic
932599333 2:73112985-73113007 CGGCGGGCGCGGGGCGGGGCAGG - Exonic
933596790 2:84290676-84290698 CCGCGGCCGCGGAAGAGGGCGGG - Intergenic
933752477 2:85611848-85611870 TGGCGGCGGCGGCGCAGGGCGGG + Intronic
934566975 2:95346592-95346614 CGGCGGCGGCGGCGCGGCGGCGG - Intronic
934966830 2:98731013-98731035 CGGCGGCAGCGGCGGCGCGCGGG - Intronic
935692593 2:105744793-105744815 GCGCGGCCGGGGAGGAGCGCGGG + Intergenic
935820157 2:106886436-106886458 CCGCCGGCGCGGAGCAGCGCTGG - Exonic
935997138 2:108786753-108786775 CTGCGGCCGCGTAGCGCCGCGGG + Exonic
936122657 2:109760349-109760371 CGGCGGCGGCGGCGCAGGGCCGG + Intergenic
936122690 2:109760418-109760440 CGGCGGCGGCGGCGCAGGGCCGG + Intergenic
936222003 2:110611055-110611077 CGGCGGCGGCGGCGCAGGGCCGG - Intergenic
936222036 2:110611124-110611146 CGGCGGCGGCGGCGCAGGGCCGG - Intergenic
936278726 2:111120775-111120797 CGGCGGCCGCGGCGCCGAGGGGG + Intronic
937310722 2:120901480-120901502 CAGAGGCCACGGAGCAGCACCGG - Intronic
938397852 2:130963963-130963985 CGGCGGCCGCGGGGCTGCCGGGG - Intronic
938406328 2:131035112-131035134 CGGGCGCCGCGGGGCCGCGCCGG - Intronic
938728774 2:134130070-134130092 CAGCAGCTGCGGAGGAGCGCCGG + Intronic
942278053 2:174336793-174336815 CGGCGGCGGCGGAGGAGCCGAGG - Exonic
943185167 2:184598315-184598337 CTGCGGCAGCGGCGCCGCGCGGG + Intergenic
945189024 2:207166922-207166944 CGGCGCCCGCGGGGCGGGGCGGG - Intronic
946329161 2:219000124-219000146 CTGTGGCAGCGGAGCAGCGGAGG + Intergenic
946354863 2:219178294-219178316 CGGCGGCGGCCGCGCAGCCCTGG + Exonic
946966441 2:225042287-225042309 CGGCGGACGCGGCGCTGTGCCGG + Exonic
947117906 2:226791542-226791564 CGGCGGGCGCGGTGCAGAGGGGG + Intronic
947641641 2:231710471-231710493 CGGGGTCCGCGGAGCGGAGCGGG + Intronic
947717956 2:232351316-232351338 AGGCCGCCGCGGTGCAGCCCTGG + Intergenic
948454603 2:238098979-238099001 CGGTGGGCGCTGAGCAGAGCAGG - Exonic
948479261 2:238239981-238240003 GGGCGGCCGCGGGGCAGCGGAGG - Exonic
948824678 2:240568498-240568520 CGGCGGCGGCGGCGGGGCGCGGG - Intronic
948845890 2:240682694-240682716 CGGTGGGCGCGGTGCAGCTCGGG - Exonic
948909568 2:240996332-240996354 CGGGGGTCGCTGAGCAGTGCTGG - Intergenic
1168830224 20:841601-841623 CAGAGGCCGCGGGGCAGGGCTGG - Intronic
1168887005 20:1266793-1266815 CACCTGCCGCGGTGCAGCGCAGG - Intronic
1169065598 20:2692879-2692901 CGGCCGCGGCGGGGCGGCGCGGG + Exonic
1169074459 20:2752433-2752455 CGGCGGCCTCGGAGCTGGCCTGG + Exonic
1170226372 20:13995616-13995638 CGGCGAGCGGCGAGCAGCGCAGG + Exonic
1171346416 20:24469527-24469549 CGCCGGGCGCGGGGCAGCGGCGG - Exonic
1171458248 20:25283802-25283824 TGCAGGCGGCGGAGCAGCGCGGG - Intronic
1171972544 20:31573210-31573232 CGGCCCCCGCGGGGCGGCGCGGG - Intronic
1172474399 20:35226542-35226564 CAGGGGCCGCGGAGCGGCGCTGG - Intergenic
1173827698 20:46058003-46058025 CGGGAGCCAGGGAGCAGCGCCGG - Intronic
1175466072 20:59191978-59192000 CGACGGCAGCGGAGAAGCCCTGG + Exonic
1176002874 20:62840836-62840858 CGGCGGCCGAGGGGCAGCCAGGG - Exonic
1176076343 20:63250066-63250088 CGGCGACCTAGGAGCAGGGCGGG + Exonic
1176178542 20:63739544-63739566 CGGAGGCCTCGGAGCTGTGCCGG + Intronic
1176194599 20:63831372-63831394 CCGCGGCCGGGGCGCGGCGCGGG - Intergenic
1176548594 21:8212224-8212246 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1176556488 21:8256432-8256454 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1176567525 21:8395259-8395281 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1176575427 21:8439474-8439496 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1177431707 21:20998302-20998324 CGGCGGCAGCAGAGCCGGGCGGG - Exonic
1179663567 21:42893584-42893606 CGGCGGCGGCGGACCGGCTCGGG - Intronic
1179913809 21:44463774-44463796 CAGCGGCCTCGGCGGAGCGCTGG - Intergenic
1180014801 21:45074923-45074945 GGGCGCCCGCGGAGAAGCGAGGG + Intronic
1180231994 21:46432166-46432188 CAGCGGCTGCGGAGCAGTGGAGG + Exonic
1180465028 22:15603356-15603378 AAGCGCCCGCGGAGCAGAGCAGG - Intergenic
1180908397 22:19431658-19431680 CGGCGGCGGCGGCCGAGCGCGGG - Exonic
1182374722 22:29838194-29838216 CGGCGGCGGCGGCACAGAGCCGG - Exonic
1183441394 22:37825025-37825047 CGGCGGCCGAGGCGCGGCGGAGG + Exonic
1184276576 22:43412244-43412266 CGACGCCCGCGGCGCTGCGCAGG + Intronic
1184663858 22:45977441-45977463 CCGCGTGCGCGGAGGAGCGCAGG - Intergenic
1185272690 22:49936083-49936105 GGGCGGCGGGGGAGGAGCGCGGG - Intergenic
1185278593 22:49960568-49960590 CGGCGGGCGCGGGGCCGCTCCGG - Exonic
1203261532 22_KI270733v1_random:173607-173629 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
949969961 3:9396603-9396625 CGGCGGCCGCGGCTCCGCCCCGG - Intergenic
953439611 3:42906418-42906440 CGGCGCGCCCGGGGCAGCGCGGG - Exonic
953627242 3:44581038-44581060 CGGCGGCGGCGGCGCAGGCCCGG + Intronic
953881633 3:46694001-46694023 CGGCGGCCTCGGAGCCTTGCAGG - Intergenic
954113156 3:48446947-48446969 CAGCGGCTGCGGAGAAGCCCCGG - Exonic
954395182 3:50289723-50289745 CGGCAGCCACGTAGCAGCCCAGG + Exonic
954540758 3:51391728-51391750 CGGCGGCAGAGGAGACGCGCGGG - Exonic
955325748 3:58008412-58008434 GGGCGGCCGCAGAGCAGCACCGG + Exonic
955769595 3:62374073-62374095 CGGGGGCCTCGGCGCCGCGCAGG + Intronic
960582747 3:119294689-119294711 CGGCGGCCCCGGAGCGGCGCGGG + Exonic
961081729 3:124033606-124033628 TGGCGGCCGCGGAGCTTCGAGGG - Intergenic
962738866 3:138348666-138348688 CGGCGGCCGCGGGGCCCGGCGGG + Intronic
963253080 3:143120005-143120027 CGGAGGCTGCGGAGCGGCGGGGG + Exonic
966815245 3:183884954-183884976 CGGCTGCCGCTCAGCCGCGCGGG - Intergenic
966849342 3:184155287-184155309 CGGCCGCCGCGGAGAGGCGCCGG - Intronic
967118195 3:186360941-186360963 AGGAGGCAGCGGCGCAGCGCGGG + Intronic
967930429 3:194686776-194686798 CGGCGGCGGCGGCGGAGCGCCGG - Exonic
968708550 4:2095627-2095649 GGGAGGCCGCGGAGCTGGGCAGG - Intronic
968850492 4:3074626-3074648 CGGCGGAGGCGGGGCCGCGCCGG - Intergenic
968965151 4:3765940-3765962 CGGCGGCGGCGGCGCAGCTCCGG + Intergenic
969714463 4:8861581-8861603 AGGGGACCGCGGAGCAGCGTAGG + Intronic
971257937 4:25030898-25030920 CGGCGGCCGCCCAGCAGCCCGGG - Intergenic
972162570 4:36244485-36244507 CGGCGGCCGAGGCGAGGCGCGGG - Exonic
976282077 4:83335131-83335153 GAGCGCCCGGGGAGCAGCGCTGG + Exonic
977257550 4:94757927-94757949 CGGCGGCGGCGGAGCGGCCGCGG + Intergenic
978503507 4:109433689-109433711 CGGCCGCCGAGTGGCAGCGCTGG + Intergenic
980063320 4:128155448-128155470 CTGCGGCCGGGGGGCTGCGCGGG - Intronic
980130011 4:128809780-128809802 CGGCGGGCGGGGAGCCGGGCGGG - Exonic
984811406 4:183798403-183798425 CTCCAGCCGCGGAGCAGTGCCGG - Intergenic
984973485 4:185210117-185210139 AGGCGGCCGCCGCGCAGCTCAGG - Intronic
985593654 5:778035-778057 CGGTGGCTGCGGAGGTGCGCCGG - Intergenic
985609032 5:876299-876321 CGGGGACCGAGGAGCTGCGCTGG - Intronic
985652096 5:1112028-1112050 CGGCGGGAGCGGCGCAGCGCGGG - Exonic
986449488 5:7850757-7850779 GGGCGGCCGCGGAGGGGCGGGGG - Intronic
986733152 5:10649713-10649735 TGGGGGGCGCGGGGCAGCGCGGG + Exonic
988941486 5:36152068-36152090 GTGCGGCCGCGAAGCAGAGCGGG + Exonic
989480481 5:41925233-41925255 CGGCTGGCGCGGAGCTGCGCAGG + Exonic
990210892 5:53480655-53480677 CGGCGAGCGCGGGGCTGCGCCGG + Exonic
990895919 5:60700124-60700146 CGGCTGGCGGGGATCAGCGCTGG - Exonic
992105871 5:73448495-73448517 CGGCAGCCCCGGCGCAGCTCCGG - Intergenic
992124516 5:73626555-73626577 CGGCGGCAGCTGCGGAGCGCGGG + Intronic
992676563 5:79111794-79111816 CTGCGGACTCGGAGCAGCTCGGG + Exonic
993726944 5:91380209-91380231 CGGCGGCGGCGGCGGCGCGCGGG - Intronic
997305011 5:132830467-132830489 CGGTGGTCGCGGGGCAGCCCGGG - Intronic
1001382261 5:171312395-171312417 CGAAGGCCGCGGGCCAGCGCCGG + Intergenic
1002352012 5:178590006-178590028 AGGCGGCCGCGCTGCAGGGCCGG - Exonic
1002415932 5:179121112-179121134 CGGAGGCGGCGGAGGGGCGCGGG - Intronic
1002698196 5:181104126-181104148 CGGCGGACGCGGAACTGTGCGGG - Intergenic
1002709034 5:181183124-181183146 CGGCGGACGCGGAACTGTGCGGG + Intergenic
1002718939 5:181246485-181246507 GGGCGGCCCCGGAGCGGAGCGGG - Intronic
1004208491 6:13614736-13614758 CTGCGGCCGCGGAGCTGGGAAGG + Intronic
1006458333 6:34144407-34144429 CGGCGGCCGCGTAGACGCGCAGG + Intronic
1006547493 6:34792049-34792071 GGGCGGCCGCGGCGCCGCGCTGG + Intronic
1006932765 6:37697614-37697636 CGGCGCCCGCGCCGCAGCCCCGG - Exonic
1007367780 6:41406920-41406942 GGGCGGGCGAGGAGCGGCGCTGG + Intergenic
1007431513 6:41779903-41779925 CCGCGGCCGCGGGGCGGGGCGGG - Intronic
1007600140 6:43076280-43076302 CGGCGGCGGCGGCGGCGCGCGGG + Intronic
1016378688 6:143450685-143450707 CCGCGGCAGAGGAGGAGCGCGGG + Intergenic
1016949444 6:149566253-149566275 GGGCGGCCGCGGAGAGGCGCGGG - Intergenic
1017672399 6:156779257-156779279 CGGCGGCGGCGGCGGCGCGCTGG - Exonic
1018613060 6:165662170-165662192 CGGCGGCCGGGGACCGGCACGGG + Intronic
1018674073 6:166203798-166203820 CGGCTGCTGCGGGGCAGGGCTGG + Intergenic
1019417943 7:935751-935773 CGGCACCCGCGGGGCAGAGCAGG - Intronic
1019681924 7:2355181-2355203 CGGCCGCCGAGGAGCTGCCCGGG + Exonic
1020034900 7:4958943-4958965 CGGCGGCCGCGGAGGTCCGCGGG - Intronic
1020278313 7:6637526-6637548 CGGCGGCGGCGGGGCCGGGCTGG + Intronic
1021521455 7:21543133-21543155 CGGCGACCGCGGAGGAGGGTGGG + Intergenic
1023000345 7:35801531-35801553 CGGAGGCCGCGGCTCTGCGCCGG - Intronic
1023638807 7:42237969-42237991 CGGCGGCGGCGGCGGAGGGCGGG - Intergenic
1027001568 7:74657970-74657992 CGGCCGCCGCGGAGCAGCCTCGG - Intronic
1028417578 7:90596342-90596364 GGGCGGCGGCGGCGCGGCGCGGG + Intronic
1029238742 7:99143836-99143858 CGGCGGCGGCGGGGCCGGGCCGG - Exonic
1029537017 7:101163056-101163078 AGGCGGAGGCGGAGGAGCGCCGG - Exonic
1030138698 7:106284561-106284583 CGGCGGCGGCGGCGCGGCGGGGG - Intronic
1030262484 7:107580257-107580279 CGGCGGCCGCGGAGCAGCGCAGG + Intronic
1030884754 7:114922995-114923017 AGGCGGCAGCGGCGCGGCGCGGG + Exonic
1033477125 7:141702010-141702032 GGCCGGCCGCGGAGCCGCCCCGG - Exonic
1034129074 7:148699070-148699092 CGGCGGCGGCGGCGCAGGCCCGG + Intronic
1034129204 7:148699504-148699526 CGTCGGCCGGAAAGCAGCGCCGG - Intronic
1034147253 7:148884206-148884228 CGGCGGCGGCGGCGGCGCGCGGG - Exonic
1034470458 7:151251892-151251914 CGGCGGCCGGGGAGCTGGGGGGG + Intronic
1035581040 8:738986-739008 CGGCGGCGGCGGCGTCGCGCAGG - Intergenic
1035752000 8:2002716-2002738 CGGCAGCCGCGGCGAGGCGCAGG + Exonic
1037273796 8:17156685-17156707 GGGCGGCGGCGGAGCTGGGCAGG + Exonic
1039454603 8:37698407-37698429 CGGCGGCGGCGGCGCTGCCCAGG - Exonic
1039843376 8:41309114-41309136 GGGCCGCCGCGGGGCAGCCCTGG - Exonic
1039921464 8:41896791-41896813 CGGCGGCGGCGGCGAAGCGGGGG + Intergenic
1040038842 8:42896768-42896790 CGGCGGCGGCGCGGCGGCGCGGG + Intronic
1040065340 8:43140429-43140451 CGTCCGCGGCGGAGCAGCGCAGG + Intergenic
1040423405 8:47260953-47260975 CGGCTGCCGCGGGGCATCTCCGG - Exonic
1041068179 8:54101995-54102017 CGGCGGGCGAGGGGCAGGGCAGG - Exonic
1041244910 8:55880351-55880373 TGTCCGCCGCGGAGCCGCGCAGG + Intronic
1043502808 8:80873845-80873867 CCGCCGCCGCCGCGCAGCGCCGG - Intronic
1045098767 8:98825452-98825474 CGGCGGCCGCGGGGCGGGGGTGG - Intronic
1045663905 8:104466434-104466456 CGGCGGCAGCCGAGCAGCCTTGG - Intronic
1048553909 8:135457376-135457398 CGGCGGGCGCGGGGCGGGGCGGG + Intergenic
1049109664 8:140635298-140635320 CGGCGGCGGCGGGGCCGAGCCGG - Intronic
1049183798 8:141238109-141238131 AGGCGTCCACGGAGCAGCACAGG - Intronic
1049396381 8:142403021-142403043 AGGCGGCCGGGGACCAGCGCGGG - Intronic
1049583467 8:143422803-143422825 CCGCGGCCGGGGAGGAGCGCCGG - Intronic
1049620904 8:143597931-143597953 CGGCGGCCGCGGCGCGGTACCGG - Exonic
1049719449 8:144108852-144108874 CATAGGCCGCGAAGCAGCGCAGG - Exonic
1049784608 8:144444442-144444464 GCGGGGCCGCGGCGCAGCGCGGG - Exonic
1049800401 8:144514991-144515013 CGCCGGCTGTAGAGCAGCGCTGG + Exonic
1049867882 8:144950653-144950675 GGGCGGGGGCGGAGCCGCGCGGG - Intronic
1049989404 9:977309-977331 CGGCGGCTGCGGGGCGGCGACGG - Exonic
1051289114 9:15527709-15527731 CGGCGGCTGCTGCGCGGCGCTGG + Intergenic
1053050566 9:34958081-34958103 CGCCGCCCGCGGAGCCGCGAGGG + Intronic
1053398902 9:37800732-37800754 CGGTGGCCGAGGGGCGGCGCGGG + Exonic
1053643123 9:40106765-40106787 CGGCGGCTGCGGCGCAGCCCGGG + Intergenic
1053763027 9:41358724-41358746 CGGCGGCTGCGGCGCAGCCCCGG - Intergenic
1054541633 9:66269838-66269860 CGGCGGCTGCGGCGCAGCCCCGG - Intergenic
1055757497 9:79571866-79571888 GGGCGGCCGCGCAGCATCCCGGG - Intronic
1056135167 9:83623502-83623524 AGGCGGCTGCGGGGCCGCGCAGG + Intronic
1059414801 9:114155988-114156010 CGGCGGCGGCGGCGGCGCGCGGG + Exonic
1060474593 9:123977192-123977214 CGGCAGCCGCGGTGCAGCAGAGG + Intergenic
1060476769 9:123992931-123992953 CGGCAGCCGCGGTGCAGCAGAGG - Intergenic
1060663562 9:125419079-125419101 CGAGTGCCGTGGAGCAGCGCTGG + Intergenic
1060822770 9:126671184-126671206 CGGCGGTGGCGAAGCAGAGCTGG - Intronic
1061540730 9:131276892-131276914 CGGCGGCCGGAGCGCAGCCCCGG - Intergenic
1062230608 9:135479821-135479843 CGGCGGCAGCGGCGGCGCGCGGG + Exonic
1062272233 9:135714807-135714829 CGGCGGCTGCGGGGGCGCGCGGG - Intronic
1062362352 9:136193860-136193882 CGGCCGCCGGGGTGCAGCGCGGG - Intergenic
1062381945 9:136290883-136290905 CAGCGGCCCTGGAGCAGCTCCGG - Exonic
1062622861 9:137430414-137430436 AGTCGGCCGTGGCGCAGCGCAGG - Intronic
1062696226 9:137877670-137877692 GGGCGGCCGCGGGGCGGGGCCGG + Intergenic
1203780698 EBV:99249-99271 CGGCGGCCTCGGAGGTGCCCGGG - Intergenic
1203469878 Un_GL000220v1:111676-111698 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1203477699 Un_GL000220v1:155648-155670 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1185471477 X:386524-386546 CGGGGGACGGGGAGCAGCCCGGG - Exonic
1185747535 X:2584423-2584445 CGGCGGCCGCTGGGCTGGGCTGG + Intergenic
1189252755 X:39613917-39613939 CGGCGGCTGCAGAGCATCACAGG - Intergenic
1189310042 X:40012496-40012518 CGGCCGGCGCGGCGCGGCGCGGG + Intergenic
1189534591 X:41923457-41923479 CGGCGGCGGCGGATCGGCGCTGG + Intronic
1192260745 X:69504768-69504790 GGGCGGGAGCGGAGCGGCGCGGG + Intergenic
1192274763 X:69616998-69617020 AGTCGGCCGGGGGGCAGCGCAGG - Intronic
1195668349 X:107449915-107449937 CGGCAGCGGCGGCGCAGCGGCGG - Intergenic
1196765114 X:119236104-119236126 CGGCCGCGGGGGAGCGGCGCCGG + Intergenic
1199772596 X:150984039-150984061 CGGCGGCGGCGGCGCCGGGCGGG - Intronic
1200129008 X:153830926-153830948 CGGCGGCGGGGGAGGGGCGCGGG + Intergenic
1200218526 X:154379399-154379421 CGGCTGCCGAGGAGCACGGCGGG - Exonic
1200229481 X:154436993-154437015 CGTCGCCCGCGGAGCCGCGCTGG + Exonic