ID: 1030265484

View in Genome Browser
Species Human (GRCh38)
Location 7:107616419-107616441
Sequence ACAGAGATATTATGGGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 1, 2: 1, 3: 28, 4: 329}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030265484 Original CRISPR ACAGAGATATTATGGGAAAT TGG (reversed) Intronic
901109311 1:6782944-6782966 ACAGCTATATTATAGAAAATAGG + Intergenic
901724578 1:11230815-11230837 ACTGAGAAATTATAGGATATTGG - Intronic
903867089 1:26407835-26407857 ACAGCCATATTATGGGAAGTAGG + Intergenic
904917014 1:33977444-33977466 ACAGAGATTTGCTGGGTAATAGG - Intronic
906225887 1:44120770-44120792 ACAGACATATAATAGGAACTAGG - Intronic
906333720 1:44909778-44909800 AGAGAGGTATTTTGGGAATTAGG + Intronic
906797842 1:48711764-48711786 TCAGAGAAATTATGGGGAAAGGG - Intronic
907259283 1:53205427-53205449 ACAGAGAGATGATGTGAAAGTGG + Intronic
909038415 1:70622126-70622148 AGAGAGAGAGGATGGGAAATAGG - Intergenic
910078564 1:83310628-83310650 ACAGAGATTTTGTAGGGAATAGG + Intergenic
910394255 1:86775965-86775987 ACAGGGTTATTGTGGGAATTAGG + Intergenic
910394709 1:86780420-86780442 AAAGAGATATAATAGGTAATAGG - Intergenic
910450502 1:87338764-87338786 AGAGAGATATGATGACAAATGGG + Intronic
910456935 1:87407830-87407852 ACAGAGATGTTGTGAGAATTAGG - Intergenic
910609893 1:89129448-89129470 ACAGTGAGGTTATGGTAAATTGG + Intronic
911101145 1:94096710-94096732 CCAGAGATAGTAGGGTAAATCGG - Intronic
913489068 1:119361546-119361568 ACAGAGTTGTTATAGGAATTAGG - Intergenic
914717850 1:150266703-150266725 ACAGAGAGAATATGGGGATTAGG - Intronic
915031649 1:152884917-152884939 AGGGAGCTATGATGGGAAATAGG - Exonic
916201973 1:162280739-162280761 ATAGATATATTATTGAAAATTGG - Intronic
917158877 1:172035032-172035054 AATGAGAAATTATGGGAATTTGG + Intronic
918974100 1:191458630-191458652 ACAAAGATTTTATTGAAAATAGG - Intergenic
919339823 1:196290821-196290843 AAAGAGACATTATGGGGAAAAGG - Intronic
919394012 1:197022544-197022566 ACAAAGAGATTATTTGAAATTGG + Intergenic
919862229 1:201747746-201747768 ACATATATAATATAGGAAATGGG - Intronic
919932885 1:202232979-202233001 ACAGGGACATCAAGGGAAATGGG + Intronic
921083664 1:211766326-211766348 AGAGATTTATTATGAGAAATTGG - Intronic
921188296 1:212688288-212688310 TCTGAGATATTCTGGTAAATTGG - Intronic
923779272 1:237007757-237007779 AGAGAGATAATATTGCAAATAGG + Intergenic
923969727 1:239186344-239186366 CCAAAGATTATATGGGAAATTGG + Intergenic
923980342 1:239314595-239314617 CCAGAGAGATTATGTGACATGGG - Intergenic
1064511530 10:16099209-16099231 ACAGGGATATTTTGGGGAACAGG - Intergenic
1064637938 10:17387705-17387727 GCAGAGAAATGAGGGGAAATGGG + Intronic
1064773564 10:18750637-18750659 ACAGTCATATCATGGAAAATGGG + Intergenic
1066178201 10:32932848-32932870 ACAGTCATATAATGGTAAATGGG + Intronic
1066592731 10:37013029-37013051 ACAGAGCTATACTGGGAAAAAGG + Intergenic
1067349393 10:45462337-45462359 ACAGAGTTAGGATGGGACATAGG + Intronic
1068292726 10:55025336-55025358 ATTGAGAAATTATGGAAAATAGG - Intronic
1068838937 10:61588826-61588848 TCAGAGATAGTCTGGGGAATTGG + Intergenic
1069185300 10:65414778-65414800 ACAGAGATATTCAGGGAACAAGG - Intergenic
1071812619 10:89199982-89200004 ACAGACCTCTTATGGGTAATGGG - Intergenic
1071880513 10:89892029-89892051 ATGGATATATTATGGGCAATAGG + Intergenic
1072265112 10:93719950-93719972 ACAGAGATCTTATGAGCAAGAGG + Intergenic
1072303681 10:94086488-94086510 ACAGAGATATAAAGGACAATGGG - Intronic
1073662489 10:105492005-105492027 ACAGAGATATAATGGTAGAATGG + Intergenic
1073808577 10:107127337-107127359 ACAGATATATCCTGGAAAATTGG - Intronic
1073857840 10:107697777-107697799 AGAGAGATCTCATGAGAAATTGG - Intergenic
1074744877 10:116522695-116522717 ACAGAGAAATAATGGGATTTGGG - Intergenic
1075739409 10:124685145-124685167 ACAGACATATTTTGCTAAATAGG - Intronic
1078127627 11:8583892-8583914 ACAGAGATAATATGGGACTAAGG + Intronic
1079450105 11:20593461-20593483 ATATATTTATTATGGGAAATAGG - Intergenic
1080733680 11:34987435-34987457 ACAGAACTATTATGTTAAATAGG - Intronic
1080843404 11:36005221-36005243 ACAAAGAGATTATCTGAAATTGG - Intronic
1081365579 11:42231140-42231162 ACAGATATAATATGAGAAAGTGG - Intergenic
1082299758 11:50491677-50491699 ACAGAGATTTACTGGGACATTGG - Intergenic
1084847837 11:71914384-71914406 ACAGAAATAGTATGAGAACTTGG + Intronic
1086014472 11:82149894-82149916 ACAGAGAAATAATGTGAAAAGGG - Intergenic
1086250373 11:84805240-84805262 ACAGAGACAGCATGGGAAACTGG + Intronic
1086731876 11:90260274-90260296 AAATAGATATTACTGGAAATAGG - Intergenic
1086943180 11:92819040-92819062 GCAGGGCTATTATGAGAAATGGG - Intronic
1087109608 11:94449415-94449437 ACAGAGAAATTTTGGCAAGTCGG - Intronic
1087704727 11:101477324-101477346 ACAGGTTTATTAAGGGAAATGGG - Intronic
1088040578 11:105376151-105376173 ACAGAGATATGGTTTGAAATAGG - Intergenic
1088338640 11:108737852-108737874 CCAAAGATATAATAGGAAATAGG - Intronic
1088528559 11:110784198-110784220 ACATAGGGATTATGGGAAAATGG + Intergenic
1090589507 11:128250431-128250453 CCAGAGCTATTTTGGGAAATAGG - Intergenic
1092130886 12:6112449-6112471 ACTGAGAAATTAATGGAAATAGG + Intronic
1092503801 12:9074310-9074332 GCAGTGTTGTTATGGGAAATAGG + Intronic
1092577947 12:9810815-9810837 ACAGAAAGATATTGGGAAATGGG - Intergenic
1096965306 12:55622113-55622135 ACAGAGAGATAATTTGAAATAGG + Intergenic
1098727444 12:73985986-73986008 ACAGAGAAATAATAGGAAAATGG - Intergenic
1099326779 12:81226280-81226302 TCAGAGATATTATGAGAACCAGG - Intronic
1100097428 12:91058568-91058590 AAAGAAATATAATAGGAAATAGG - Intergenic
1100158497 12:91829978-91830000 CCAGAGACATTATGGGTCATGGG + Intergenic
1101449715 12:104765021-104765043 ACAGGGACTTTATGGGAAAAAGG - Intergenic
1103242648 12:119427696-119427718 ACTTAGAAATTATGGGAAAATGG - Intronic
1106842002 13:33693796-33693818 AGAGACATGTAATGGGAAATTGG - Intergenic
1106997769 13:35507531-35507553 ACAGCAATATTTTGGGAATTGGG - Intronic
1107034797 13:35890057-35890079 ACACATATATTATAGAAAATTGG - Intronic
1107094797 13:36524797-36524819 ACAGAAATATTAAGGGAATAAGG - Intergenic
1107103388 13:36618126-36618148 ACAGAGATTTTAGGGGAAGGGGG - Intergenic
1107392666 13:39983247-39983269 ACAGGGATATTAGTGGGAATGGG + Intergenic
1108896831 13:55340222-55340244 AAAAAGATATTATAGGAAAATGG - Intergenic
1109342157 13:61075881-61075903 ACAGAGATATGATGTAAAATTGG + Intergenic
1110580868 13:77123612-77123634 ACAGAGATATTAGGTTAACTTGG + Intronic
1115051920 14:29073066-29073088 ACAGAGATATGATTTGCAATTGG - Intergenic
1115259155 14:31435625-31435647 ACATAGCTACTATAGGAAATGGG - Intronic
1116630615 14:47326744-47326766 AGAGAGAAATTCAGGGAAATTGG + Intronic
1116778843 14:49213169-49213191 AGAGAGATAGAAGGGGAAATTGG - Intergenic
1117274661 14:54180465-54180487 ACATTGAGATTATGGTAAATAGG + Intergenic
1118083280 14:62386965-62386987 ACAGAGAGATTATTTGAAATGGG + Intergenic
1118355076 14:65006817-65006839 ACTGAGATATGAGGGAAAATGGG + Intronic
1119571238 14:75675325-75675347 ACAAAAATAGCATGGGAAATAGG - Intronic
1120377701 14:83730352-83730374 ACAGAGAGATTATCAGAAAATGG - Intergenic
1120684668 14:87524447-87524469 ACAGAGATGTGATGAGAAAGGGG + Intergenic
1121238012 14:92406994-92407016 ACAAAGAGATTATCTGAAATTGG - Intronic
1121333207 14:93060881-93060903 ACAGAGCTATTATGAGAACTAGG + Intronic
1124064609 15:26329959-26329981 AGAGAGTTATTATGAGAAACTGG + Intergenic
1124392457 15:29271891-29271913 ACCGAGATATAAGGGGAAAGTGG + Intronic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1125245722 15:37636444-37636466 ACAGACAGATAATGGGCAATGGG - Intergenic
1127003727 15:54541561-54541583 TCAGAGGTAGTATGGGACATTGG + Intronic
1127671547 15:61199711-61199733 ACTGAGATGTTATGGGAAGGGGG + Intronic
1127913689 15:63438375-63438397 GGAGAGATATCAGGGGAAATGGG + Intergenic
1128384928 15:67140810-67140832 ACAGACAGAGTGTGGGAAATGGG + Intronic
1130756702 15:86771895-86771917 GCAGAGTCATTAAGGGAAATGGG + Intronic
1132022517 15:98375144-98375166 ACAGACATGTCATTGGAAATGGG + Intergenic
1133910298 16:10059877-10059899 ACAGAGATAATACAGGAAATTGG + Intronic
1137222463 16:46469829-46469851 CCAGAAATCTTTTGGGAAATAGG + Intergenic
1137894007 16:52191497-52191519 AAAGAAAAATTATGGGAAACAGG - Intergenic
1138064935 16:53930966-53930988 ACAGATATTTTGTGGGCAATGGG + Intronic
1138319422 16:56099211-56099233 ACAGAGATATTAGGGTAAGTAGG - Intergenic
1138889467 16:61124574-61124596 GCAGAGATATTTTGTGATATTGG - Intergenic
1141262974 16:82470451-82470473 ACCCACATATTATGAGAAATTGG + Intergenic
1141845928 16:86608960-86608982 ACAGAAATCTTTTGGGAATTGGG + Intergenic
1142537402 17:628460-628482 AATGAGATATTTTGGGAAATGGG + Intronic
1142650528 17:1348213-1348235 ATACAGATATTAGGGGAAAAAGG + Intronic
1142909960 17:3080390-3080412 ACAAAGACATTATCTGAAATTGG - Intergenic
1142924546 17:3223418-3223440 ACAAAGAGATTATCTGAAATTGG + Intergenic
1143987723 17:10929581-10929603 ACTGAAATATAATGGGAGATGGG + Intergenic
1147377857 17:40033476-40033498 ACAGAAACATGATGGGAAACAGG + Intronic
1148784075 17:50136781-50136803 ACAGAGGTAGTGTGGGAGATGGG - Intronic
1149971843 17:61226886-61226908 AAAGGGATATTATAGGATATAGG - Intronic
1155801612 18:30111922-30111944 ACAAAGATGTTATGGTAAATAGG - Intergenic
1156568142 18:38219860-38219882 ACAGAGATAGTATGCCTAATAGG + Intergenic
1156683862 18:39620925-39620947 AAAGAGGTATTCTGTGAAATTGG + Intergenic
1157194995 18:45613800-45613822 ACAGAGAGATTGTTTGAAATTGG + Intronic
1158008658 18:52702907-52702929 TAAGAGTTGTTATGGGAAATAGG - Intronic
1158821270 18:61161980-61162002 AAAGATTTATTATGAGAAATTGG + Intergenic
1159025250 18:63177674-63177696 ACAAAGTTATTCTGGCAAATTGG + Intronic
1159437443 18:68437614-68437636 AAAGAGATTTCATGGGAAAAGGG - Intergenic
1159994578 18:74951418-74951440 ACAGAGATCTTGTAGAAAATTGG + Intronic
1162272983 19:9631360-9631382 AAAGAGAAATTAAGGAAAATAGG + Intronic
1163410013 19:17148312-17148334 ACAGAGATAATGTTGGAAAGGGG - Intronic
1165676678 19:37731609-37731631 ACATAGATATTGTAGGAAATCGG - Intergenic
1168329758 19:55560812-55560834 CCAGAGAAATGATGAGAAATGGG - Intergenic
925454227 2:4000834-4000856 AGAGATGTATTATGAGAAATTGG + Intergenic
925990546 2:9250962-9250984 ACAGAGATAAGATGGGAACCCGG + Intronic
926459764 2:13114474-13114496 AAAGAGAGATTATAGGAAATTGG + Intergenic
926845791 2:17137256-17137278 ATAGAAGTATTTTGGGAAATTGG + Intergenic
926959098 2:18333950-18333972 ACACTGATTTTTTGGGAAATAGG - Intronic
928564587 2:32531855-32531877 TTAGAGATATTATTGGAAATAGG + Intronic
929685805 2:44033156-44033178 ACTGATAAATCATGGGAAATGGG - Intergenic
930568663 2:53056321-53056343 ACACAGATATTTTAGGAAAAAGG + Intergenic
931017936 2:58007187-58007209 AGAGATTTATTATGAGAAATGGG - Intronic
931900615 2:66783920-66783942 AGTGAGATATTGTGGAAAATGGG + Intergenic
932566358 2:72913647-72913669 ACAGAGATCTTGTGAGAATTTGG - Intergenic
933002068 2:76937386-76937408 ACAATGATGTGATGGGAAATTGG + Intronic
933805314 2:85994862-85994884 TCAGAGAAATCCTGGGAAATTGG + Intergenic
936775740 2:115970502-115970524 ACAAAGAAATTATGTGCAATGGG - Intergenic
936975266 2:118213946-118213968 TCAGAGAGATTATGTAAAATTGG - Intergenic
938369540 2:130760671-130760693 ACAGAGGTATTTTGGGTGATAGG + Intronic
938955279 2:136291909-136291931 ACAGAGAAAATATGGGAAGAAGG - Intergenic
940499597 2:154477667-154477689 ACAAAGAGATTATGTGAAACTGG + Intergenic
943248325 2:185484586-185484608 ACAGAGAGATGATCTGAAATTGG + Intergenic
943297796 2:186160588-186160610 ATAAAGAGATTATGTGAAATTGG + Intergenic
943988027 2:194647720-194647742 TCAAAGATATGATGGAAAATTGG - Intergenic
944128074 2:196317001-196317023 ATCCAGATATTTTGGGAAATTGG - Intronic
944289694 2:197991381-197991403 AGAGAGAGATTATGAGTAATTGG - Intronic
945742960 2:213685790-213685812 AGAGAGAAATCATTGGAAATAGG + Intronic
946566934 2:220976519-220976541 ACTGAGATATTAGGAGAAAGAGG + Intergenic
946643052 2:221804792-221804814 ATAAAGATATTATAAGAAATTGG - Intergenic
947466537 2:230354098-230354120 ACAGAAATATTATGGGAAATGGG - Intronic
947481580 2:230505369-230505391 AAACAGATGTTATGGGAAATGGG - Intronic
949052921 2:241906980-241907002 ACACAGACATTTTTGGAAATGGG + Intergenic
1169753414 20:9018978-9019000 ACAAAGATATGAAGGGAAAATGG + Intergenic
1170039737 20:12027384-12027406 ACAGTGATATTATGGAGAAATGG + Intergenic
1170394402 20:15910343-15910365 TCAGAGAAGTAATGGGAAATTGG + Intronic
1172536741 20:35679498-35679520 ACAGGCATATAATGTGAAATAGG + Intronic
1172647993 20:36483548-36483570 ACAGAGAAAAAAGGGGAAATGGG + Intronic
1173791026 20:45827782-45827804 ACAGAGAGACCATGGTAAATGGG + Intronic
1174733897 20:52945733-52945755 AGAGATTTATTATGAGAAATTGG + Intergenic
1175736674 20:61391996-61392018 ATGGAGATATTATGGGATAGGGG + Intronic
1177085310 21:16695528-16695550 ACAAAGAGATTATCAGAAATTGG - Intergenic
1177140642 21:17353887-17353909 ACAGAAATATTCAAGGAAATAGG + Intergenic
1177662110 21:24098239-24098261 ACAAAGAGATGATGTGAAATTGG + Intergenic
1178345920 21:31827938-31827960 AGGCAAATATTATGGGAAATGGG + Intergenic
1179435993 21:41362489-41362511 ACGGTGATATGCTGGGAAATTGG + Intronic
1180176279 21:46091647-46091669 CCAGAGATTTAATTGGAAATAGG - Intergenic
1182237383 22:28885835-28885857 AGAGAGATAATATGTGAATTTGG + Intronic
1182884100 22:33758605-33758627 GCAGATAGATTATGGGAAACTGG - Intronic
1182975003 22:34615232-34615254 ACAGAGATCTTGTGGGATAAAGG + Intergenic
1203295698 22_KI270736v1_random:41215-41237 AGAGAGATATTATAAGGAATTGG + Intergenic
949285622 3:2400282-2400304 ACATATATATTATGGAAAAATGG - Intronic
950039300 3:9909574-9909596 ACAGAGCTGTGATGGGAACTGGG - Intronic
950051612 3:9995407-9995429 ACTGATAAAATATGGGAAATAGG + Intronic
950058509 3:10049149-10049171 ACTGATAAAATATGGGAAATAGG + Intronic
951447405 3:22798724-22798746 ATAGAGATAAGATGGGGAATAGG - Intergenic
951960837 3:28318408-28318430 ACAAAGAGATTTTGGGAAAATGG - Intronic
952043416 3:29287621-29287643 ACAGAGATGTTATCGTAAAGAGG + Intronic
957448807 3:80349085-80349107 ACAAAAATATTATTTGAAATTGG - Intergenic
958145628 3:89621099-89621121 ACAGATTTATTATGAGGAATTGG + Intergenic
959139932 3:102473348-102473370 ACATAGATATTTTGGGCAACTGG - Intronic
959964152 3:112334475-112334497 ACATAGTTATTATGAGAATTAGG - Intronic
960334456 3:116399446-116399468 AGAGAGATGTTAAGTGAAATTGG + Intronic
960437982 3:117650944-117650966 AAAGAGATAATATGAGAAGTGGG - Intergenic
960974305 3:123160202-123160224 ACAGAGGTGTTATGGAAGATGGG - Intronic
961259397 3:125588446-125588468 AGAGAGAGATTATGAGGAATTGG - Intronic
963420153 3:145051835-145051857 ACACAGAGATTATAAGAAATTGG - Intergenic
963690025 3:148487752-148487774 ACAGATATATTAAAAGAAATTGG - Intergenic
963986669 3:151603606-151603628 ACAGATCTATTATAAGAAATTGG + Intergenic
964099849 3:152975744-152975766 AAAGAGAGATTTGGGGAAATTGG - Intergenic
964650814 3:159009269-159009291 ACAGAGATTTGATGGCAAGTGGG - Intronic
965283657 3:166787361-166787383 AAATAGATATGATGGGAATTAGG - Intergenic
965569265 3:170154925-170154947 ACAGAGAAATTAATGGAAACTGG - Intronic
971543464 4:27852868-27852890 ACAGTGATATGCTGGTAAATAGG - Intergenic
972192920 4:36616366-36616388 TGAGAGATATTATTTGAAATTGG - Intergenic
972465079 4:39347837-39347859 AGAAAGAGATTATTGGAAATTGG + Intronic
973337416 4:48970713-48970735 AGAGATTTATTATGTGAAATTGG - Intergenic
974351177 4:60748904-60748926 AGAGAGAGATTATAGGGAATTGG + Intergenic
974756180 4:66210898-66210920 AGAGAGATATAAAGGGAAACAGG - Intergenic
975258748 4:72271305-72271327 ACAGATTTATTATAAGAAATTGG - Intergenic
975379481 4:73681928-73681950 ACAGAGATCTTTTGGTAAGTAGG - Intergenic
976007917 4:80452912-80452934 TCAGAGACATCATGAGAAATGGG + Intronic
976946900 4:90781391-90781413 ACAGAGATTTTATGGGACAGGGG - Intronic
978041726 4:104072691-104072713 ACTAAGAGATTATAGGAAATGGG - Intergenic
978428878 4:108611454-108611476 ACAGAGAACTACTGGGAAATAGG + Intergenic
978635349 4:110798075-110798097 ACAGAATTATTTTGGGAATTAGG + Intergenic
979549239 4:121971896-121971918 AGAGATTTATTATGAGAAATTGG + Intergenic
979719879 4:123886537-123886559 TAAGAGATGATATGGGAAATAGG + Intergenic
981155732 4:141432884-141432906 ACAAAGATCATAAGGGAAATAGG - Intergenic
981358409 4:143819328-143819350 ACAGAGCTATTCTAGGTAATGGG + Intergenic
981953985 4:150447612-150447634 AGAGATTTATTATGAGAAATCGG - Intronic
982613480 4:157609178-157609200 GCAGAAATATTGTGGAAAATTGG + Intergenic
983488424 4:168359434-168359456 AAAGAGATATTATGACAAATTGG - Intronic
983699378 4:170572763-170572785 ACAGAGATGTTATAAGGAATTGG - Intergenic
986582270 5:9278368-9278390 ACAAAGAGATTATCTGAAATTGG + Intronic
986891734 5:12317420-12317442 ACATAAATGTAATGGGAAATTGG - Intergenic
987209474 5:15665113-15665135 AAAGAGAGATTCAGGGAAATGGG + Intronic
988293352 5:29319750-29319772 AGATAGATATTATGAGAAATTGG - Intergenic
989272203 5:39546603-39546625 TCAGAGATATTATGGGGAAAAGG - Intergenic
989452068 5:41598103-41598125 AGAGATTTATTATGAGAAATTGG + Intergenic
989825055 5:45844058-45844080 ACACAAATATAATGGGAAATGGG + Intergenic
990042827 5:51393278-51393300 ACAGAGATCTTTTGGAAGATGGG + Intronic
990146305 5:52764538-52764560 ACAGAGAGATTATGAAAAATTGG + Intergenic
990420939 5:55632686-55632708 ACACAGAAATAGTGGGAAATTGG - Intronic
991694857 5:69261319-69261341 ACAGAGAAAATATGAGAAACTGG - Intronic
992999392 5:82365433-82365455 ATAGAGATATTATGGAACATAGG + Intronic
993253176 5:85554140-85554162 ACAAAGATATGATCTGAAATTGG - Intergenic
994382648 5:99089467-99089489 TCAGAGAGAACATGGGAAATAGG + Intergenic
995118879 5:108514981-108515003 AATGAGATATTAAGGGACATTGG - Intergenic
995164900 5:109028031-109028053 ACAGAGTTATTGTGGGAAAATGG + Intronic
995397894 5:111707648-111707670 ACATAGAGATTCTGGGATATTGG + Intronic
996897451 5:128502429-128502451 ACAGAAATATGAAGGGAAAAAGG + Intronic
998759307 5:145414406-145414428 ACAGAGATATGCTGGACAATGGG - Intergenic
998975537 5:147642384-147642406 ATAGAGATATCATGGGAATTTGG + Intronic
999392220 5:151201755-151201777 GCAGAGAGAGTGTGGGAAATGGG + Intronic
1000717483 5:164664112-164664134 ACAGCTATAATATGGGAAAATGG - Intergenic
1000767782 5:165313383-165313405 ACAGAGACATTCTGGGACTTTGG - Intergenic
1000821617 5:165991501-165991523 AGGGACATATTATGGGAAATTGG + Intergenic
1000896461 5:166861140-166861162 ACAGTGATATTATAGAAATTAGG - Intergenic
1000968061 5:167683209-167683231 ACAGAGATATTAGAGGATACAGG - Intronic
1001898817 5:175405258-175405280 AGAGATTTATTATGGGAGATTGG + Intergenic
1003265595 6:4562619-4562641 ACAGTCACATTCTGGGAAATTGG - Intergenic
1004527272 6:16420917-16420939 GCAGAGACATTATGCAAAATTGG - Intronic
1005218109 6:23555096-23555118 TCAGAGAGATTATCTGAAATTGG - Intergenic
1005555648 6:26979872-26979894 AAAGAGATATTTAGTGAAATGGG - Intergenic
1005828555 6:29651739-29651761 ACACAAATATTATGGGAAATAGG + Intergenic
1005969406 6:30749504-30749526 ACAGAGATCTAATGAGAAAAAGG - Intergenic
1008140644 6:47827966-47827988 TCAAAGATATTATGGGAAGAAGG + Intronic
1008204182 6:48632855-48632877 ACAGATATATAGTAGGAAATGGG + Intergenic
1009527509 6:64765061-64765083 ACAAAGAGATTATCTGAAATTGG - Intronic
1009620875 6:66075112-66075134 ACAGGAGTTTTATGGGAAATTGG - Intergenic
1009967259 6:70590790-70590812 AGAGAGAGATTATGTGGAATTGG + Intergenic
1010112784 6:72260653-72260675 ACAGATAAATTATGAGACATGGG - Intronic
1011349294 6:86404745-86404767 ACAAAGATATTATTGGAGGTTGG + Intergenic
1011491405 6:87897137-87897159 ACAGAGAAATTAGGGTAAAGAGG + Intergenic
1011501478 6:87995283-87995305 ACAGTGAAATAATGGGAAACAGG + Intergenic
1012567899 6:100682993-100683015 ACAGCGTTATTGTGTGAAATTGG + Intronic
1013861771 6:114644297-114644319 AAAGATTTATTATGAGAAATTGG - Intergenic
1016522070 6:144957083-144957105 ATAGAGTTATTATGAGGAATTGG + Intergenic
1016600186 6:145849661-145849683 AGAGAGAAATTATGAGGAATTGG + Intergenic
1018896409 6:168021292-168021314 ACAGATATTTTATAGAAAATGGG - Intronic
1019214968 6:170437660-170437682 CCAGAGATATAATGGGAGCTGGG + Intergenic
1020570697 7:9857488-9857510 AAATAAATATTATGGGAAAAGGG - Intergenic
1020697336 7:11429902-11429924 ACAGATTTGTTTTGGGAAATGGG + Intronic
1021438297 7:20647422-20647444 AGAGAGATATTAGAGGAATTAGG - Intronic
1021494997 7:21264673-21264695 GCTGAGATGTTATGGCAAATTGG - Intergenic
1021849960 7:24797681-24797703 ACACAGAAATTTTTGGAAATGGG - Exonic
1024012677 7:45283450-45283472 AGAGAGATATTATGAGAGATTGG + Intergenic
1024159527 7:46660044-46660066 AGAGAGGTAATATGGGAATTGGG + Intergenic
1025030604 7:55553714-55553736 ACAGAGATATCAGGGGAACCAGG - Intronic
1026121272 7:67540042-67540064 AAAGAAATAATCTGGGAAATGGG - Intergenic
1026761071 7:73126092-73126114 AAAGAGCAATTATGAGAAATGGG + Intergenic
1027037411 7:74934888-74934910 AAAGAGCAATTATGAGAAATGGG + Intergenic
1027086150 7:75266567-75266589 AAAGAGCAATTATGAGAAATGGG - Intergenic
1027341216 7:77210183-77210205 ACAAAGAGATTATCTGAAATTGG - Intronic
1028012890 7:85671572-85671594 GCAGAGATATTAAGGGATTTGGG + Intergenic
1028351009 7:89847988-89848010 TCAGTGTTATTATGGGTAATTGG + Intergenic
1028547230 7:92015805-92015827 ACAGAGATAACATCAGAAATAGG + Intronic
1028659064 7:93246923-93246945 AAAAAGGTATTATGGGAATTGGG - Intronic
1029392454 7:100284591-100284613 AAAGAGCAATTATGAGAAATGGG - Intergenic
1030119439 7:106093504-106093526 AAAGAGGTGTTATGGGAAAATGG - Intronic
1030265484 7:107616419-107616441 ACAGAGATATTATGGGAAATTGG - Intronic
1030610762 7:111686531-111686553 ATAGAAATGTTATGGGAAGTTGG + Intergenic
1031273925 7:119693691-119693713 AGAGAGAGATTATGAGAAATTGG + Intergenic
1033677124 7:143553614-143553636 ACAGTGATTTTCAGGGAAATAGG - Intergenic
1033694711 7:143775823-143775845 ACAGTGATTTTCAGGGAAATAGG + Intergenic
1034142399 7:148833574-148833596 ACATAAATATTAAGGGTAATGGG + Intronic
1034390235 7:150781401-150781423 AGAGAGATATTAGGGGGAGTTGG - Intergenic
1035214286 7:157353358-157353380 ACAGAAAGATTAAGGGAAGTTGG - Intronic
1036238916 8:7066771-7066793 TCACAGATATTATGTGGAATGGG - Intergenic
1037245842 8:16833909-16833931 ATAGAAATATTAAGGGAAAATGG + Intergenic
1037542186 8:19882924-19882946 AGAGATATATTATGAGGAATTGG + Intergenic
1037894802 8:22644823-22644845 AGAGAGATATTGTGAGAAGTGGG + Intronic
1038742026 8:30224639-30224661 ACAGAGATTTTTTGGGGCATGGG - Intergenic
1040999002 8:53431121-53431143 ATAGAGATATGATGAGATATTGG - Intergenic
1042569066 8:70142782-70142804 AGAAAAATATTATGGGAAAAAGG + Intronic
1042879684 8:73473329-73473351 ACAGAAATATTATTGGATCTGGG - Intronic
1043883110 8:85567376-85567398 ACATATATATAATGGGATATAGG - Intergenic
1044326473 8:90864693-90864715 ACAGAGAAATGATGGGAGAGAGG - Intronic
1045426071 8:102066984-102067006 ACAGAGATATTGGGTGAAAATGG + Intronic
1045895059 8:107205958-107205980 ACAGAGCTATTATGTCAATTAGG - Intergenic
1046478507 8:114782207-114782229 AAAGAGAGAAGATGGGAAATAGG + Intergenic
1047660277 8:127026058-127026080 ACAGAAATGTTATTGGAAAATGG + Intergenic
1048673786 8:136753685-136753707 AAAGAGACATTAGGAGAAATCGG + Intergenic
1048946372 8:139452025-139452047 AAAGAGATTTTATGAGACATTGG - Intergenic
1051212593 9:14760343-14760365 ACAGAGATATTCTCTGAACTTGG + Intronic
1051963133 9:22792603-22792625 ACATAGAAATTATAGTAAATAGG + Intergenic
1052190444 9:25655422-25655444 ACAGACATATAATAGAAAATGGG - Intergenic
1052266130 9:26575883-26575905 ACAGAGATCTCATTGAAAATGGG - Intergenic
1052468890 9:28867332-28867354 AGAGAGATTTTATGAGAAAAGGG - Intergenic
1054695322 9:68354966-68354988 ACAGGAACTTTATGGGAAATGGG + Intronic
1055223091 9:73962674-73962696 AGAGAGAGATTATGAGGAATTGG + Intergenic
1055475177 9:76656312-76656334 AAATATATATTATGGTAAATGGG - Intronic
1055677218 9:78676266-78676288 AAAGAGATATTAAGGGATAGGGG - Intergenic
1056450062 9:86708076-86708098 GCAGAGATATGATGTGCAATGGG - Intergenic
1057336541 9:94160088-94160110 ACAGATTTATTATGAGGAATTGG + Intergenic
1057429349 9:94979971-94979993 ACAGAGAAATGAATGGAAATGGG - Intronic
1057986726 9:99724349-99724371 TAACAGATATTATGGAAAATGGG - Intergenic
1058245991 9:102625917-102625939 ACAAAGATATTATTTGGAATTGG - Intergenic
1058305014 9:103429191-103429213 AAAGAAATATTTTGGGAGATTGG + Intergenic
1058451173 9:105097888-105097910 ACAGAGATATTTTTGGATAGAGG - Intergenic
1185574607 X:1161069-1161091 ACAGAGGGATTATGGGAGCTAGG + Intergenic
1185654817 X:1676426-1676448 ACAGAGAGATTTTAAGAAATTGG - Intergenic
1185921618 X:4099259-4099281 ACAGATTTATTATGGAGAATTGG - Intergenic
1188548783 X:31338735-31338757 ACAGAGATTTCCTGGAAAATGGG + Intronic
1188662421 X:32775933-32775955 ACAGAGAGATTATCTGAAATGGG - Intronic
1188799491 X:34510242-34510264 ACAGAGATATGGAGGGAAAAAGG - Intergenic
1188982229 X:36736693-36736715 AGAGATTTATTATGAGAAATTGG - Intergenic
1189530594 X:41877807-41877829 ACGTAGATATTATGGGAAGAAGG - Intronic
1189737375 X:44085744-44085766 AGAGAGAGATTATAGGGAATTGG + Intergenic
1190473129 X:50802435-50802457 TCTGAGAGATTATGGGAATTGGG - Intronic
1191945328 X:66527966-66527988 AAAGAGATTTTATGGGCAAGAGG + Intergenic
1192327257 X:70143338-70143360 ACAGAGATTTTATGGTGAAGAGG + Intronic
1192722402 X:73712877-73712899 TTAGAGATATCATGGAAAATGGG - Intergenic
1193469901 X:81887545-81887567 ACACAGATCTTAAGGGAAATTGG + Intergenic
1193512666 X:82424158-82424180 ACAGAGATATTTTGAGATCTAGG + Intergenic
1195091296 X:101462065-101462087 AGAGATATATTAAGTGAAATAGG + Intronic
1195633235 X:107082840-107082862 ACAGTGATATTATAAGGAATAGG - Intronic
1196114956 X:111989111-111989133 ACAAAGTCATTATGGAAAATGGG - Intronic
1196743450 X:119046204-119046226 AGAGAGAAATTATTAGAAATCGG - Intergenic
1197401990 X:126004506-126004528 ACAGTCATATTATGTAAAATGGG + Intergenic
1197434716 X:126412543-126412565 ATAGATTTATTATGAGAAATTGG + Intergenic
1197669489 X:129260559-129260581 ACAGAAATATTAGAGGAAAGAGG + Intergenic
1197674867 X:129318258-129318280 ACAGAGAAATAATAGGAAAAAGG - Intergenic
1199370158 X:147037820-147037842 AAAGACATATACTGGGAAATAGG - Intergenic
1200355684 X:155547966-155547988 GTAGTGAGATTATGGGAAATGGG - Intronic
1201525983 Y:14935060-14935082 ATAGATTTATTATGAGAAATTGG + Intergenic
1201964574 Y:19717584-19717606 AAAGAGATATTTTGGGAAAAAGG + Intronic