ID: 1030272568

View in Genome Browser
Species Human (GRCh38)
Location 7:107686087-107686109
Sequence TCTCTGTGGTGTGTGTGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030272564_1030272568 1 Left 1030272564 7:107686063-107686085 CCAGCCTGGAATGCAGTGGCATG 0: 22
1: 2180
2: 36741
3: 104961
4: 190764
Right 1030272568 7:107686087-107686109 TCTCTGTGGTGTGTGTGTGTGGG No data
1030272563_1030272568 2 Left 1030272563 7:107686062-107686084 CCCAGCCTGGAATGCAGTGGCAT 0: 20
1: 2309
2: 38638
3: 135070
4: 215092
Right 1030272568 7:107686087-107686109 TCTCTGTGGTGTGTGTGTGTGGG No data
1030272565_1030272568 -3 Left 1030272565 7:107686067-107686089 CCTGGAATGCAGTGGCATGATCT 0: 19
1: 436
2: 1264
3: 2376
4: 3117
Right 1030272568 7:107686087-107686109 TCTCTGTGGTGTGTGTGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030272568 Original CRISPR TCTCTGTGGTGTGTGTGTGT GGG Intronic
No off target data available for this crispr