ID: 1030273080

View in Genome Browser
Species Human (GRCh38)
Location 7:107690925-107690947
Sequence TCTCTTCGACTGTGTCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030273080_1030273082 -5 Left 1030273080 7:107690925-107690947 CCAGCAGGACACAGTCGAAGAGA 0: 1
1: 0
2: 0
3: 9
4: 141
Right 1030273082 7:107690943-107690965 AGAGACCACACCAAGCAGATGGG No data
1030273080_1030273085 14 Left 1030273080 7:107690925-107690947 CCAGCAGGACACAGTCGAAGAGA 0: 1
1: 0
2: 0
3: 9
4: 141
Right 1030273085 7:107690962-107690984 TGGGCACAAGAGACAGACTCAGG 0: 1
1: 0
2: 3
3: 52
4: 480
1030273080_1030273081 -6 Left 1030273080 7:107690925-107690947 CCAGCAGGACACAGTCGAAGAGA 0: 1
1: 0
2: 0
3: 9
4: 141
Right 1030273081 7:107690942-107690964 AAGAGACCACACCAAGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030273080 Original CRISPR TCTCTTCGACTGTGTCCTGC TGG (reversed) Intronic
906144106 1:43550027-43550049 TCTCCTGTGCTGTGTCCTGCGGG + Intronic
906647379 1:47485217-47485239 TCTCTTCCCCTTTATCCTGCTGG - Intergenic
906692701 1:47803120-47803142 TCTCCTCGGCTGTCTCCTCCAGG + Intronic
910721107 1:90287090-90287112 TCTTCTTGACTGTGTTCTGCTGG + Intergenic
912550140 1:110480082-110480104 TCTCTTAGACTGTGCTCTGTAGG + Intergenic
921601704 1:217113137-217113159 TTTCTCAGACTGTTTCCTGCTGG - Intronic
923123390 1:231014672-231014694 TCTCTTAGGCTGTGCCCTGGAGG + Intergenic
923392232 1:233523794-233523816 TCTCTTTGACTTTATCCTGGAGG - Intergenic
1063448438 10:6134856-6134878 TGTCTTCTTCTGGGTCCTGCAGG - Intergenic
1069512995 10:69056217-69056239 TCTCTTCCTGTGTGGCCTGCAGG + Intergenic
1070552942 10:77505216-77505238 TCACTTGGACTGGTTCCTGCTGG - Intronic
1070834394 10:79438774-79438796 TCTCCTCTGCTTTGTCCTGCTGG - Intronic
1075579883 10:123609418-123609440 TCTCTTCGACTGGGCACTACTGG + Intergenic
1076434399 10:130430290-130430312 TCTCTTCCAGTGTGGCCTCCTGG + Intergenic
1078023331 11:7673002-7673024 TCTCTTTGCCTATTTCCTGCAGG - Intronic
1080183749 11:29454626-29454648 TCTCTTTGTCTGTTTCCTGGTGG - Intergenic
1081802020 11:45866545-45866567 TCTGTGCCACTGAGTCCTGCAGG - Intronic
1086005478 11:82030588-82030610 TCGCATCGCCTGTGACCTGCAGG + Intergenic
1089133307 11:116229331-116229353 TCTCTTGGCCTCTGTCCTACAGG - Intergenic
1089686668 11:120153728-120153750 TCTATTCGACAGTGTACTGGAGG - Intronic
1091317255 11:134623260-134623282 TCTCTGTGACCGTGTCCTGCAGG - Intergenic
1091351585 11:134901835-134901857 CCTTTTCGACTGACTCCTGCAGG + Intergenic
1091703679 12:2679849-2679871 TCTCCTCCACTGTCTCCTGAGGG - Intronic
1092260464 12:6950975-6950997 TGTCATCGAGTGAGTCCTGCTGG - Intronic
1093507512 12:19885706-19885728 TATCTCCTACTGTGTCCTGTTGG - Intergenic
1094174076 12:27524101-27524123 TCTCTTTGGCTGATTCCTGCAGG + Intronic
1097623047 12:61964800-61964822 TCTTTTGGACTGGGTCCTGAAGG - Intronic
1099752920 12:86801383-86801405 TCTCTTCCACTGAGTCCTTGGGG - Intronic
1099926956 12:89030279-89030301 GCTCTTCTACAGTGTCCTCCAGG + Intergenic
1102674034 12:114644272-114644294 TCTCTTGGAATGTATCCTGGGGG + Intergenic
1102969852 12:117157776-117157798 CCTCCTCCACTGTGTCCTGGGGG + Intronic
1103503448 12:121423450-121423472 CGTCATCGACTGTGTCCTACTGG + Exonic
1103950858 12:124550261-124550283 TCTTCTTGAATGTGTCCTGCAGG - Intronic
1106411957 13:29516881-29516903 TCTCTTGGCCTGTGTCATGCAGG + Intronic
1106412677 13:29521963-29521985 TCCCTTGGCCTGTGTCATGCAGG + Intronic
1107301085 13:38966222-38966244 TCTCTTGCTGTGTGTCCTGCAGG - Exonic
1108458627 13:50642711-50642733 TCTCTGCAACTGTGTGTTGCGGG + Intronic
1109306635 13:60648712-60648734 TCTCTTCTACTAGGTCCTACTGG - Intergenic
1109755591 13:66755356-66755378 GCTCTCCAACTATGTCCTGCAGG - Intronic
1112591610 13:100768393-100768415 TTCCTTTGAATGTGTCCTGCTGG + Intergenic
1113268401 13:108645030-108645052 TCTCTGCTACTGTTTCCTGGGGG - Intronic
1121721989 14:96115760-96115782 TGTCTTCAACTCTGTCCTGTGGG + Intergenic
1124678492 15:31709067-31709089 TCTCTCCCTCTCTGTCCTGCAGG - Intronic
1128339439 15:66810150-66810172 TCTCTTTGTCAGTGTCTTGCTGG - Intergenic
1128520691 15:68372722-68372744 TGTCTTAGTCTGGGTCCTGCAGG - Intronic
1130983095 15:88826413-88826435 GCTCTTCCACAGTGTCCTTCAGG - Intronic
1137506496 16:49058266-49058288 GCTCTTTTCCTGTGTCCTGCAGG - Intergenic
1138356931 16:56389566-56389588 ACACTTCCAGTGTGTCCTGCTGG + Intronic
1140525074 16:75616022-75616044 TCTTTTTGACTGAGTCTTGCCGG + Intronic
1141080032 16:81042467-81042489 TCCCTTCACCTGTGTTCTGCAGG - Exonic
1141803692 16:86328228-86328250 TCTCTTGGACTCTGGGCTGCTGG + Intergenic
1142328253 16:89432519-89432541 CCTTTTCTACTGTGTCCAGCTGG + Intronic
1142586212 17:975581-975603 TCTCTTCCCCTTTGTCATGCAGG + Intronic
1143085759 17:4414805-4414827 TCTATTCAACAGTGTACTGCAGG - Intergenic
1146525688 17:33565175-33565197 TCCCTCCAACTCTGTCCTGCAGG + Intronic
1147553280 17:41460239-41460261 TCTCTTTGACTTTCTCCTGCAGG - Exonic
1148688661 17:49514373-49514395 TGACTTCGACTGTGACCTGTGGG + Exonic
1152859804 17:82689527-82689549 CCACCTCGCCTGTGTCCTGCAGG - Intronic
1155529987 18:26757340-26757362 TGTCTTAGACTGTGCCCTGCAGG + Intergenic
1159894707 18:73985413-73985435 TCTCTTCTACCTTGTCCTTCTGG + Intergenic
1160343812 18:78112777-78112799 TCTCCTTGACCGTGTGCTGCGGG - Intergenic
1160775208 19:852358-852380 TTTCCTCGCCTGTGTCCTGCCGG + Exonic
1161768000 19:6217386-6217408 GCTCTCCCACTGTGTCCTGCAGG + Intronic
1162326381 19:10002199-10002221 CCTCTCTGACTGTGGCCTGCTGG - Intronic
1162876489 19:13624480-13624502 TCTCTTCCACTGGTTCCTGTCGG + Intergenic
1163797222 19:19344622-19344644 TCTCTTCCACTCTGTCCAACAGG - Intronic
1164573761 19:29393075-29393097 TCTCTTCCTCTGTGTCTTTCAGG - Intergenic
1164590211 19:29502495-29502517 TCTCTGGGACTGAGCCCTGCTGG - Intergenic
925589192 2:5493338-5493360 ACTCTTCGACTGAGACCTGAAGG - Intergenic
926646046 2:15290762-15290784 TCTCTTCTCCTCTGTCCTTCTGG - Intronic
928599973 2:32894958-32894980 TCTCTGAGACTGTGTCATGAGGG + Intergenic
931081785 2:58781812-58781834 TTTCTCCGACTGTTTCCTGTGGG - Intergenic
931688413 2:64814701-64814723 TCACTTCTACTGTGTCCTATTGG + Intergenic
937785145 2:125887292-125887314 TCTCTTCACCTCTGTCCTTCAGG + Intergenic
939398943 2:141666788-141666810 TCTCCTAGAGTTTGTCCTGCTGG - Intronic
939777673 2:146406294-146406316 TTTGTTCGTCTGTGCCCTGCCGG - Intergenic
944997384 2:205309186-205309208 TGTCTTAGAATGTGTACTGCAGG - Intronic
947471976 2:230409166-230409188 CATCTTTAACTGTGTCCTGCTGG + Intergenic
948225476 2:236306274-236306296 TGTCTTCCACAGTGTCCTGCTGG - Intergenic
1168931406 20:1627258-1627280 TCCCTGCGATTGGGTCCTGCTGG - Intergenic
1169626767 20:7579878-7579900 TCTCTTCACCTGTGTCATTCAGG + Intergenic
1170891051 20:20375747-20375769 TGCCTTTGAATGTGTCCTGCTGG - Intergenic
1171369398 20:24651750-24651772 TCACTTCTGCTGTGTCCTACTGG - Intronic
1172632227 20:36386166-36386188 TCTCTGGTTCTGTGTCCTGCTGG - Intronic
1173897599 20:46562797-46562819 TCTCTCCCCATGTGTCCTGCAGG + Intronic
1175819408 20:61900545-61900567 TCTCTGGGCCTGTGTCCTGTTGG - Intronic
1176515686 21:7781741-7781763 TCTCTGGGGCTGTGTCCTGGAGG + Intergenic
1178649714 21:34411753-34411775 TCTCTGGGGCTGTGTCCTGGAGG + Intergenic
1180223741 21:46376580-46376602 TCCCTTGGCCTCTGTCCTGCCGG + Intronic
1183457682 22:37931672-37931694 TCTCTTTGCCTGGGTCCTGCTGG + Intronic
949244345 3:1908066-1908088 GCTCTTCAAATGTTTCCTGCTGG - Intergenic
950388743 3:12679754-12679776 TCTCTTCCACTGTGCTCTACTGG + Intergenic
950665905 3:14494842-14494864 GCCCTTCGACAGGGTCCTGCAGG - Exonic
950888890 3:16385706-16385728 ACTCTTTGACTGTGCCCTCCTGG - Intronic
954843307 3:53532236-53532258 TATCTTACTCTGTGTCCTGCAGG + Intronic
955513714 3:59706600-59706622 TCTCTTTGCCTGTGGCATGCTGG - Intergenic
956602938 3:71042392-71042414 CCTCTTCGTCTTTATCCTGCTGG + Intronic
959603816 3:108220892-108220914 TCTCTTGCACTGTGTCCTCAGGG - Intronic
961309054 3:125981848-125981870 TCTCCTCTACTGTGTCTTGCTGG + Intronic
961422519 3:126817578-126817600 CCTCATGGACTGTGCCCTGCTGG - Intronic
961627616 3:128274733-128274755 TCCCATCCACTGTGCCCTGCAGG + Intronic
962709894 3:138077525-138077547 TCTCTTCCAGGGTGTCCTCCAGG + Exonic
963597722 3:147348909-147348931 TCTGTTCTGCAGTGTCCTGCTGG + Intergenic
965208216 3:165749469-165749491 TCCCTTCTACTGTGTCCAGATGG + Intergenic
966548687 3:181181022-181181044 TTTATTTCACTGTGTCCTGCTGG - Intergenic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
968933064 4:3593669-3593691 TGTCATCCACTGTCTCCTGCCGG + Intergenic
969227407 4:5807910-5807932 GCTTTTCTACTCTGTCCTGCTGG + Intronic
970570169 4:17372608-17372630 TCTCTTAGACTATATCCTCCAGG - Intergenic
972631334 4:40844466-40844488 TCTCTTCGGCTGGGTTGTGCTGG + Intronic
974915740 4:68175622-68175644 TCTATTCTTCTGTCTCCTGCTGG + Intergenic
983303243 4:165954562-165954584 TCTCTTGCCCTGTGACCTGCAGG + Intronic
985231365 4:187821382-187821404 TCTGTTCTAATGTGTCCAGCGGG + Intergenic
985313758 4:188632263-188632285 TCTCTATGACTGGGTCCTCCTGG - Intergenic
987376658 5:17241753-17241775 TCCCTTCAACTGTGCTCTGCAGG + Intronic
993415379 5:87622768-87622790 TCTCTTCCACTGTTACCTGGCGG - Intergenic
997614818 5:135239172-135239194 TCTCATCGACAGTGGCCAGCAGG + Intronic
997732908 5:136193658-136193680 CCTCTCCGGCTGCGTCCTGCCGG + Intergenic
1000167122 5:158661480-158661502 TCTCTTTGAGTTTATCCTGCAGG - Intergenic
1000579915 5:163023538-163023560 TCTCTTTGAATTTTTCCTGCTGG - Intergenic
1000913995 5:167057890-167057912 TCCCTATGACTGGGTCCTGCTGG + Intergenic
1004427121 6:15514026-15514048 CCTTCTCGACTGTGCCCTGCTGG + Intronic
1005990500 6:30899031-30899053 TCTCCTCCACTCTGACCTGCCGG - Exonic
1006026200 6:31148644-31148666 CCTCTGCGGCTTTGTCCTGCAGG + Exonic
1008185773 6:48388765-48388787 TCTCTTCAATGGTGTACTGCAGG + Intergenic
1012522574 6:100138381-100138403 TCTCTTTGACTTTCTCCTCCTGG - Intergenic
1015842287 6:137488699-137488721 CCTGTCTGACTGTGTCCTGCGGG + Intergenic
1020382941 7:7566460-7566482 TCTCCTTGCCTGTTTCCTGCCGG + Intergenic
1021634522 7:22678628-22678650 GCTCTTAGACTCTGTCATGCAGG - Intergenic
1024361171 7:48470038-48470060 TCTCTGCAGCTGTGTCCTGTAGG + Intronic
1026601887 7:71784297-71784319 TCTCTGCATCTGTATCCTGCTGG - Exonic
1028335894 7:89654306-89654328 TCTCTTTTACAGTGTCTTGCTGG + Intergenic
1030273080 7:107690925-107690947 TCTCTTCGACTGTGTCCTGCTGG - Intronic
1031978482 7:128108562-128108584 TCTTTTCCACTGTATCATGCAGG - Intergenic
1040613010 8:49004645-49004667 TCTTTTCCACTTTGTCCTGTTGG + Intergenic
1042074317 8:64973385-64973407 TGTCTTCCACTGTCTACTGCTGG - Intergenic
1045166813 8:99615736-99615758 TCTCTGGGCCTGTTTCCTGCTGG + Intronic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1047129051 8:121997893-121997915 TCTGTTTGCCTGTTTCCTGCTGG - Intergenic
1047993983 8:130315972-130315994 TCCCTTCGCCTGTGCCCTTCGGG + Intronic
1049092221 8:140524812-140524834 TCGCTTGCACTGTGCCCTGCTGG + Intergenic
1052731453 9:32291213-32291235 TCTCCTTGAGTGGGTCCTGCTGG + Intergenic
1053148224 9:35726437-35726459 TGTCTCCTGCTGTGTCCTGCTGG + Intronic
1054895987 9:70311904-70311926 TCTCTTCAACATTGTCCTGGAGG - Intronic
1056183709 9:84110985-84111007 TCTCTTCTACTTGGTCCTCCTGG + Intergenic
1059213045 9:112532529-112532551 TTTCTTTGACTGTTTCCTGGAGG + Intronic
1060028755 9:120195871-120195893 TCTCTGACCCTGTGTCCTGCAGG - Intergenic
1187238211 X:17488025-17488047 TCTCCTCACCTGTATCCTGCCGG + Intronic
1193713440 X:84907060-84907082 TATCTTAAACTGTGTCCTGGAGG + Intergenic
1195395235 X:104403531-104403553 TCTATTCAACAGTGTACTGCAGG - Intergenic
1198241416 X:134790945-134790967 TCTCTTCCACAGTCTCCTGTTGG - Intronic