ID: 1030273240

View in Genome Browser
Species Human (GRCh38)
Location 7:107692465-107692487
Sequence GCATTTACAAGTATGTGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030273240_1030273241 -2 Left 1030273240 7:107692465-107692487 CCTTAGCACATACTTGTAAATGC 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1030273241 7:107692486-107692508 GCTCATTGTTTCACTCCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030273240 Original CRISPR GCATTTACAAGTATGTGCTA AGG (reversed) Intronic
906829583 1:49017175-49017197 GCATGTACTAGTATGTACTACGG + Intronic
908771769 1:67603859-67603881 TCATTTATAAGTAGGAGCTAAGG + Intergenic
911992171 1:104713009-104713031 ACTTCTACAAGTATGTGTTATGG - Intergenic
919844911 1:201635962-201635984 GCAGTTACAAGTTTCAGCTATGG + Intronic
921420196 1:214938402-214938424 GCGGTTACATGTATCTGCTATGG - Intergenic
923142611 1:231173699-231173721 GAATTTAATAGTAAGTGCTATGG + Intronic
923269867 1:232346077-232346099 GGTTTTACAAGTGTGTGCTCCGG - Intergenic
1063245251 10:4211017-4211039 GTATTTACAAGTCTGTACTTGGG + Intergenic
1069552428 10:69373972-69373994 GCATTTTGAAGGATGTGATAAGG - Intronic
1073974481 10:109085605-109085627 ACACTTACAAGGCTGTGCTATGG - Intergenic
1079315379 11:19403763-19403785 GTGGCTACAAGTATGTGCTATGG + Intronic
1080678263 11:34447996-34448018 GCATTTACTAGTGTGTGAGAGGG + Intronic
1081429428 11:42960110-42960132 GCATATAAAAATATTTGCTATGG + Intergenic
1081554639 11:44147129-44147151 GGGTGTACAAGTATGTGCTGGGG - Intronic
1087420554 11:97920062-97920084 GCATTTTCTAGTAAGTGCTATGG - Intergenic
1087975552 11:104541467-104541489 GCATTTACAATTATTTACTTTGG - Intergenic
1090145893 11:124322081-124322103 GAATTTAAAATTACGTGCTATGG + Intergenic
1093310339 12:17574466-17574488 GCCATTACAAATATGTGCTCTGG - Intergenic
1094082415 12:26552081-26552103 TCATTTACAAGTCTCTGCTGTGG - Intronic
1095341068 12:41088965-41088987 GCATTTCTAATTATGTCCTAAGG + Intergenic
1098084413 12:66826747-66826769 GCATTTAGAATTTTGTGCTTTGG - Intergenic
1099160110 12:79230096-79230118 CCATCTACATGTATGTCCTATGG - Intronic
1103964906 12:124632497-124632519 GCATTTACAAGCAGGTGACATGG - Intergenic
1105835687 13:24209363-24209385 GCACTTAAAAGTATGGGGTAAGG + Intronic
1106015582 13:25865984-25866006 CCATTTTCAAGTATTTGCTTTGG - Intronic
1107072205 13:36283004-36283026 GCATTTAGAAATAGTTGCTAGGG - Intronic
1110558889 13:76888695-76888717 ACTTTTACAAGGATGTGCAAAGG - Intergenic
1111641522 13:90976664-90976686 TCATTTGAAAGTATCTGCTATGG + Intergenic
1112854491 13:103750163-103750185 ACATTTAAAAATATGTGTTAAGG + Intergenic
1114973436 14:28063347-28063369 GCATTTACAAGTATCTAAAAAGG + Intergenic
1114985563 14:28224149-28224171 GCATTGGCAAGTATGTACTTAGG + Intergenic
1115126768 14:30004562-30004584 GCATGTACAAGAATGTGTAATGG + Intronic
1116511240 14:45749534-45749556 GCATTAACAAGATTGTACTATGG + Intergenic
1120033190 14:79665960-79665982 GCATTTATAAGTATGGGCCTTGG + Intronic
1121381641 14:93475478-93475500 ACATTTACAATTCTGTGTTATGG + Intronic
1123126817 14:105952743-105952765 GCGTTTACAGGTGTGTGCCAAGG + Intergenic
1123407300 15:20028744-20028766 GCATTTACAGGTGTGTGCCAAGG + Intergenic
1123516627 15:21035400-21035422 GCATTTACAGGTGTGTGCCAAGG + Intergenic
1125985358 15:44045534-44045556 GCATATACAAGTATGTACATAGG - Intronic
1126369216 15:47928154-47928176 GCATTTAAAAGTATTTTATAGGG + Intergenic
1129329337 15:74818987-74819009 GCCCTTACATGTATGTGCTCTGG - Intronic
1129945700 15:79537765-79537787 CCACTTACAAGTATTTCCTAAGG + Intergenic
1131526940 15:93160067-93160089 GCCTTTACAAGTATGTGCCTCGG - Intergenic
1131914128 15:97244550-97244572 TCAGTAACAAGTATGTGGTAAGG - Intergenic
1132125648 15:99221806-99221828 GCACTGACAAGAATTTGCTATGG - Exonic
1132140723 15:99391368-99391390 ACATCTCCAAGTCTGTGCTAAGG - Intergenic
1132357267 15:101181051-101181073 GCAGTTACAAGGACCTGCTACGG + Intronic
1137905816 16:52320864-52320886 ACATGTAAAAGCATGTGCTAAGG - Intergenic
1138165781 16:54800503-54800525 GATTTTAGAAGTATGTGCAAAGG - Intergenic
1139805405 16:69561360-69561382 GGAATTACAAGTATGAGCCACGG - Intergenic
1145218285 17:21068599-21068621 GCAGTTACAAGTATTTACTGAGG - Intergenic
1145361425 17:22215467-22215489 GCATTTACAGGCATGAGCCACGG + Intergenic
1147486578 17:40820826-40820848 GCATTTTAAAGTAACTGCTAAGG - Intronic
1148396891 17:47315548-47315570 GGAATTACAAGTGTGAGCTACGG + Intronic
1149173830 17:53845472-53845494 GCATTTTCTAGTATATGATATGG + Intergenic
1150794790 17:68228690-68228712 GCATCTATTATTATGTGCTAGGG + Intergenic
1153601660 18:6786724-6786746 GCTTTTAAAACTATTTGCTATGG + Intronic
1155339379 18:24798715-24798737 TCATTGACAAGTATGAGTTACGG + Intergenic
1156590389 18:38481566-38481588 GCATGCACAAGCATGTGCTTCGG + Intergenic
1159104429 18:63989641-63989663 GCATTTAAAAAAATGTGCTTAGG + Intronic
1161213864 19:3083179-3083201 GGATTTACAAGTATGAACCACGG + Intergenic
1162130757 19:8524924-8524946 GGATTAACAAGCATGAGCTACGG - Intronic
1165936096 19:39389943-39389965 GCAGCTACTACTATGTGCTAGGG + Intronic
925533987 2:4895832-4895854 ACATTTACCTGTATGAGCTATGG + Intergenic
928188979 2:29144199-29144221 GAATTTAGAAGCATGAGCTAAGG + Intronic
928210558 2:29320455-29320477 CCATCAACAAGTATGTGCTGAGG - Intronic
928975580 2:37083572-37083594 TCATTTAAAAGTATGTTCTCAGG - Intronic
930431329 2:51280168-51280190 ATATTTACAAGTATTTCCTAAGG + Intergenic
932101842 2:68908409-68908431 GCGTGTACAAGTATGTGGAATGG + Intergenic
933022170 2:77207822-77207844 TCATTTACCAGTATCTGGTATGG - Intronic
934759666 2:96847022-96847044 GCATTTACAAATATGTGCATTGG - Intronic
935291520 2:101614616-101614638 GCATTTGGAAGTATTTGATAAGG - Intergenic
936409260 2:112240135-112240157 ACATTTACAAGTTTATTCTATGG - Intronic
937749175 2:125453892-125453914 GTATTTACCAGAATGGGCTATGG - Intergenic
938020083 2:127899204-127899226 TCTTTTACAATTATGTGATAAGG - Intergenic
939123227 2:138143335-138143357 GATTGTACAAGTATTTGCTATGG + Intergenic
939507771 2:143070555-143070577 GAATTTACAAGTTTTTACTAGGG - Intergenic
939797332 2:146662321-146662343 GTTTTTATAAGTATGTGCCAAGG - Intergenic
942084190 2:172428518-172428540 GCATGTAAAAGTATCTCCTAAGG - Intronic
944256839 2:197631763-197631785 GCATTTCCATGTCTGTTCTAGGG - Intronic
945351928 2:208790481-208790503 GCATTTATATTTATGTCCTATGG + Intronic
947460228 2:230297823-230297845 GCATTTTCAAGTAAGTGGTGTGG + Intronic
1170757123 20:19213970-19213992 ACAGTTACAAGTATGTGCTGTGG + Intronic
1173922192 20:46754645-46754667 GGTTTTACAAGTGTGAGCTACGG + Intergenic
1175372346 20:58500506-58500528 GCATTTCCAAGGACCTGCTATGG - Intronic
1175720448 20:61282846-61282868 GCATTTGCACGCATGTGCTGTGG + Intronic
1175720468 20:61283531-61283553 GCATTTACACGCGTGTGCTGTGG + Intronic
1175720470 20:61283568-61283590 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175720471 20:61283607-61283629 GCATTTGCACGTGTGTGCTGTGG + Intronic
1178180384 21:30154117-30154139 GCATTTATATGTATGTGTAATGG + Intergenic
1178967809 21:37140297-37140319 GCATTTACTAGTACGCACTAAGG - Intronic
1180923742 22:19537785-19537807 GAATTAACAAGTGTGAGCTACGG + Intergenic
1184076653 22:42183675-42183697 GTATTAACAAGTTTGTGGTAAGG + Intronic
949298365 3:2553541-2553563 GCATTTAACAGTGTGTCCTAAGG + Intronic
949762935 3:7492104-7492126 TCATTTACAAATATGCGCTGAGG + Intronic
950206084 3:11082241-11082263 GGATTTCCATGTCTGTGCTAGGG - Intergenic
955548175 3:60054486-60054508 TCATTGACAAGTGTGTGCTTGGG - Intronic
959014580 3:101119526-101119548 GCATTTCCAAATATATCCTATGG + Intergenic
959157189 3:102681099-102681121 TCATGTAGCAGTATGTGCTAGGG + Intergenic
960100446 3:113736920-113736942 GCAGTTAAAATTATGTGCCAAGG - Intronic
963593485 3:147294561-147294583 GCATTTAGAAGGATTTGCTTTGG + Intergenic
965941443 3:174187446-174187468 GCATTTTCATGTGTGTGCCAGGG - Intronic
966580248 3:181553499-181553521 GCATATACAAGTAATTGCTGAGG + Intergenic
968163127 3:196443314-196443336 GCTATTACAAGTATGAGCCACGG - Intergenic
969163479 4:5282176-5282198 GCAGTTTCAGGTATCTGCTAGGG - Intronic
973709347 4:53612967-53612989 GCAGTGAAAAGTATATGCTATGG + Intronic
975648001 4:76564632-76564654 GCAGTTATCATTATGTGCTACGG - Intronic
976069931 4:81230124-81230146 GCATTTAAAACTAGGTGATATGG + Intergenic
978267401 4:106842802-106842824 GCATTTACAAGTCAGTGAAATGG + Intergenic
979091644 4:116490682-116490704 GTATTTATAAGCATGTGCAATGG - Intergenic
980428797 4:132663050-132663072 GCATTAAGAAATATGAGCTATGG - Intergenic
987515591 5:18902988-18903010 ACATTTAAAATTATGTGCTAAGG + Intergenic
990622334 5:57573598-57573620 TCAGTTACAAGTTTGTGCTGAGG + Intergenic
991568527 5:68030377-68030399 GCATTTACAAGGGGGAGCTATGG - Intergenic
993820557 5:92609969-92609991 GCAAATAAAAATATGTGCTAAGG - Intergenic
993961519 5:94303061-94303083 GCATATACACATATTTGCTATGG + Intronic
996286468 5:121799113-121799135 GAATTTAGAAGTATGGGCAATGG + Intergenic
1000695410 5:164375234-164375256 GCCTTTCCAAGTTTTTGCTAAGG + Intergenic
1007094391 6:39204449-39204471 GCATTTTCTTGAATGTGCTATGG - Intronic
1007331575 6:41114687-41114709 GGAGTTACAACAATGTGCTATGG + Intergenic
1009730422 6:67596380-67596402 GAATTTAAAAGCATGTGCAATGG - Intergenic
1010469510 6:76210224-76210246 GCATCTACATGTATGTGGTGAGG - Intergenic
1012967657 6:105692242-105692264 GCATTTACAAGTGTGCCTTAAGG + Intergenic
1013673435 6:112430459-112430481 GAATTTACATGTATGTGAAAAGG + Intergenic
1014176040 6:118332299-118332321 GCATTTACAAATATGACTTATGG - Intergenic
1016718201 6:147258732-147258754 GCACTTAAAATTATGTGTTATGG - Intronic
1018052955 6:160027551-160027573 GCAAATACAGGTATGTACTATGG - Intronic
1018975019 6:168558036-168558058 GCATTCACAGGTGTGTGCCACGG - Intronic
1020812518 7:12864353-12864375 GCACTTTCAAGTCTGTGGTAGGG + Intergenic
1023036847 7:36138658-36138680 GCATTGCCATGTATGTCCTAGGG - Intergenic
1029993266 7:104982163-104982185 TCTTTTACATGTATGTGTTAAGG - Intergenic
1030085957 7:105815891-105815913 GCATTTAGGAGAATGTGCAATGG + Intronic
1030273240 7:107692465-107692487 GCATTTACAAGTATGTGCTAAGG - Intronic
1037873326 8:22521075-22521097 GCATGGACAAGTATGTCCCATGG + Intronic
1038766058 8:30428746-30428768 CCATTTACAAGTACGTACTGTGG + Intronic
1041162364 8:55058645-55058667 ACATTTACAAAAATGTACTAGGG - Intergenic
1041329522 8:56709859-56709881 GAATTAATATGTATGTGCTAGGG - Intergenic
1042509133 8:69592961-69592983 CCAGGTGCAAGTATGTGCTATGG + Intronic
1044230102 8:89764489-89764511 GCATTTAGAAAAATGTGGTATGG + Intronic
1044415453 8:91934254-91934276 GAATTTCCAAGAATGTGATATGG - Intergenic
1046598926 8:116295255-116295277 TCATTCACAAGTATGTGGAAGGG + Intergenic
1060444129 9:123671668-123671690 GCATTTAAAAGTTGTTGCTATGG - Intronic
1185778205 X:2823214-2823236 GCATTTACATGTATGTGTGTGGG - Intergenic
1186059273 X:5686255-5686277 GAATCTACAACTATGGGCTAAGG + Intergenic
1193187101 X:78526468-78526490 AGTTTTACAAGTATGTTCTAAGG - Intergenic
1196346343 X:114664269-114664291 ACATATGCAAATATGTGCTATGG + Intronic
1199408590 X:147492893-147492915 GCATTTTCAAGTATGAGTTTTGG - Intergenic
1199605645 X:149576894-149576916 TCATTTTCAAATATGTGTTATGG - Intergenic
1199633476 X:149792474-149792496 TCATTTTCAAATATGTGTTATGG + Intergenic
1201345974 Y:12985175-12985197 GCACTGAAAAGTATGTGCTTTGG + Intergenic