ID: 1030273678

View in Genome Browser
Species Human (GRCh38)
Location 7:107696795-107696817
Sequence GTTCCCCTCTAGGCCCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030273678_1030273686 28 Left 1030273678 7:107696795-107696817 CCCTCCTGGGCCTAGAGGGGAAC 0: 1
1: 0
2: 1
3: 23
4: 185
Right 1030273686 7:107696846-107696868 CCATCGTCTTTCCAGACTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030273678 Original CRISPR GTTCCCCTCTAGGCCCAGGA GGG (reversed) Intronic
900463759 1:2813680-2813702 ATCCCCCTCTGGGCCCGGGAGGG - Intergenic
900565071 1:3328118-3328140 GTTCCCCACTTGGCCCGGCAGGG - Intronic
901427498 1:9191722-9191744 GTTTCCCTGGGGGCCCAGGATGG - Intergenic
901812899 1:11777889-11777911 GGACTCATCTAGGCCCAGGAGGG - Intronic
902649889 1:17830122-17830144 CTTCTCCTCTAGAGCCAGGAGGG - Intergenic
904002535 1:27347090-27347112 GTCTCCCTCTATGCCCAGGCTGG - Intronic
904679780 1:32221338-32221360 GTTTCCCTCTTTGCCCTGGAAGG - Intronic
905863643 1:41365649-41365671 GTTCCCCTCCAGGCCTAGGATGG + Intronic
906068978 1:43003668-43003690 TTTCCCCTCTACTTCCAGGATGG - Intergenic
906802046 1:48746437-48746459 GGTCCCCTCAAGGCTCACGAAGG + Intronic
908024909 1:59939979-59940001 GTTCCCTCCTGGGCCAAGGAAGG + Intergenic
910599837 1:89019316-89019338 GTTTCGCTCTATGCCCAGGCTGG + Intronic
912537326 1:110384577-110384599 GTTCCCCTCTAGACCCCTGTGGG - Intronic
912681771 1:111733598-111733620 CTTCCCCTCCAGCCCCAGGCAGG - Intronic
916145885 1:161739070-161739092 GTACCCCTGTAGCCCCAGTAAGG + Intergenic
917239835 1:172936288-172936310 ATTCCCCTCTACTCACAGGAAGG + Intergenic
920701809 1:208223606-208223628 GTCCTCTTCTAGGCCCAGGCAGG + Intronic
920825623 1:209421982-209422004 GTTTCTCTCCCGGCCCAGGAGGG + Intergenic
922617199 1:226967938-226967960 ATTCCCCACTAGGGCCAGAACGG - Intronic
923612108 1:235504577-235504599 GTCCCGCTCTGGGCCCAGGCAGG + Intergenic
923847517 1:237752279-237752301 GTGCACCTGTAGGCCCAGGTGGG - Intronic
1062767536 10:76763-76785 GTTCCCGTCAAGGCACGGGATGG - Intergenic
1064392992 10:14957661-14957683 GTCTCCCTCTATGCCCAGGCTGG + Intergenic
1065050350 10:21785660-21785682 GTTGCCATGTAGGCCCAGGAGGG - Intronic
1067828762 10:49597980-49598002 GTTCCCTTCCAGGCAGAGGAAGG + Intergenic
1070421103 10:76238181-76238203 CTTCCCCTCTAGAACAAGGATGG - Intronic
1070653392 10:78254094-78254116 TTTCCCATCTAGGGCCAGCATGG - Intergenic
1070813234 10:79308742-79308764 GATGCCCTCAGGGCCCAGGAAGG - Intronic
1071922077 10:90361764-90361786 GTTTTCCAGTAGGCCCAGGAGGG - Intergenic
1072028198 10:91486534-91486556 GTTCCCCTCTAGGTTCAGGCTGG - Intronic
1075623300 10:123943795-123943817 GTGTCCCTCTAGGCCCAAGACGG - Intergenic
1075875631 10:125803644-125803666 GTTCCCGTCTAGGCCTGGGGAGG + Intronic
1076013164 10:127006636-127006658 CTTCTCCTCGAGGCTCAGGATGG + Intronic
1077354500 11:2108936-2108958 GTTGCCCTCTTGGCCCAGGCTGG - Intergenic
1078180850 11:9008728-9008750 GTTTCCCACTAGGCTCAGAAGGG - Intergenic
1078534240 11:12160441-12160463 TGTCCCCTCCAGGCCAAGGAGGG - Intronic
1079022260 11:16918918-16918940 ATTCACCCCTAGGCCCAGCACGG + Intronic
1079321831 11:19457776-19457798 GTTCTCCCCTCTGCCCAGGACGG - Intronic
1080569321 11:33542103-33542125 GTCCCCCTTTAGGCCCCGGTTGG - Intronic
1080894988 11:36441601-36441623 CTTGCCCTCTAGACCCAAGAAGG - Intronic
1083707908 11:64529407-64529429 GTTCCCCTCCAGTCCCTGGGAGG - Intergenic
1084425787 11:69083967-69083989 GTTCTGCACCAGGCCCAGGACGG - Exonic
1084689312 11:70715925-70715947 GCTCCCCTCTGGGCCCAGGCCGG - Intronic
1085174208 11:74472535-74472557 GTTTCCCTCTCTGCACAGGATGG + Intergenic
1089127785 11:116189531-116189553 GTTCCCCTCGCTGCCCAGGAGGG - Intergenic
1089759521 11:120712752-120712774 TTCCTTCTCTAGGCCCAGGAGGG - Intronic
1091428137 12:409544-409566 GTTTCACTCTGTGCCCAGGATGG + Intronic
1097056894 12:56255752-56255774 GTTCCCATCCAGGCCCAGCTGGG - Intronic
1099456426 12:82868522-82868544 TTTCCCCTTTGGGCTCAGGAGGG + Intronic
1099483106 12:83193414-83193436 GTGTTCCTCTATGCCCAGGAAGG + Intergenic
1099562216 12:84192692-84192714 GTTCCCCTCTAGCCCAGAGATGG + Intergenic
1100004412 12:89876832-89876854 CCTCCCATCTATGCCCAGGAGGG + Intergenic
1100792030 12:98141093-98141115 GATCCAATCTAGGCCAAGGAAGG - Intergenic
1101860697 12:108480148-108480170 GTTCACCTCCAGGGCCAGGCTGG - Intergenic
1103065768 12:117896027-117896049 GTTTCACTCTTAGCCCAGGATGG - Intronic
1104349616 12:128033685-128033707 TTCCTCCTCTAAGCCCAGGAGGG - Intergenic
1104476441 12:129074305-129074327 GTTCCCTTCGAGGAGCAGGAAGG - Exonic
1104721663 12:131047930-131047952 CTTCTCCTCCAAGCCCAGGATGG + Intronic
1104948662 12:132428853-132428875 GCTCCACCCCAGGCCCAGGAGGG + Intergenic
1105541222 13:21319186-21319208 GTGCTCCTCAAGGCCCGGGAAGG + Intergenic
1109203105 13:59452881-59452903 TCTTCCCTCTGGGCCCAGGAAGG + Intergenic
1110560447 13:76906044-76906066 GTTCCCCTCATGGTCCAGGAAGG + Intergenic
1115311763 14:31985225-31985247 GCTCCCCACTAGTCCCAGGTGGG + Intergenic
1117676200 14:58157138-58157160 GTTTCGCTCTTGGCCCAGGCTGG - Intronic
1118388914 14:65280238-65280260 TGTCCCCGCCAGGCCCAGGATGG - Intergenic
1118736791 14:68706736-68706758 CTCCTCCTCTAGGCCCAGCAGGG + Intronic
1119179016 14:72591983-72592005 GTTTGTCTCTAGTCCCAGGAGGG + Intergenic
1120047689 14:79827106-79827128 GTCCCCCACTAGGCCCACAAGGG - Intronic
1120951460 14:90045841-90045863 GTACTCCTCTAGGCCTGGGAGGG - Intergenic
1122924680 14:104894157-104894179 TTTCCCCCTTAGGCCCAGGTGGG + Intronic
1127259259 15:57316544-57316566 GTGCCACTTCAGGCCCAGGAAGG - Intergenic
1127272222 15:57412072-57412094 GTTGCCCTCTTGGCAGAGGAAGG - Intronic
1128563123 15:68681671-68681693 GTGCCCCTCGAGGGCCAGGCAGG + Intronic
1133333702 16:4992202-4992224 GTTCTGCTCTTGGACCAGGATGG - Intronic
1134505734 16:14805372-14805394 GTTCCCCTCTAGGGCCTTCAGGG - Intronic
1134574846 16:15323575-15323597 GTTCCCCTCTAGGGCCTTCAGGG + Intergenic
1134727600 16:16432899-16432921 GTTCCCCTCTAGGGCCTTCAGGG - Intergenic
1134939833 16:18278928-18278950 GTTCCCCTCTAGGGCCTTCAGGG + Intergenic
1137676031 16:50304302-50304324 CCTCCCCTCTCGGCCCAGGAAGG - Intronic
1137850865 16:51741118-51741140 GTGACCCTCTAGCCACAGGATGG - Intergenic
1139383472 16:66549388-66549410 GTGTTCCTCTAGGCCCAGGGCGG + Intronic
1139455947 16:67076589-67076611 GGTCACCTCTAGGAACAGGAGGG + Intronic
1140743272 16:77960437-77960459 GTGCCCCTTCAGGCCCAGGGTGG - Intronic
1140819153 16:78647134-78647156 GTCCCCAGCTAGACCCAGGATGG - Intronic
1142222094 16:88860567-88860589 GCTCCCATCTGGGACCAGGATGG - Intronic
1142338999 16:89508513-89508535 GTTCCCCGCCAGGCCCGGGAGGG + Exonic
1142712932 17:1733140-1733162 CTTCCCCTCTGGGCCCTGCACGG + Intronic
1143017301 17:3897829-3897851 GTTCTCCTGCAGGCCCAGGGTGG + Exonic
1144702426 17:17348214-17348236 GTTCCCTTCAAGGGCCATGATGG - Intergenic
1146496807 17:33329910-33329932 GTTCCCCTCTTGCCCCAAGTAGG - Intronic
1148125240 17:45233316-45233338 CTTCCTCTCTGGGCCTAGGAAGG + Intronic
1149500626 17:57149654-57149676 CTTCCCCTCTGTGCCCAGCAGGG - Intergenic
1151306965 17:73268727-73268749 GTTTCCCTCTGAGCCCAGGGAGG - Intergenic
1151682475 17:75629277-75629299 CCTCCCCTCTGGGCCCAGGGAGG + Exonic
1151958936 17:77394855-77394877 TTTCCCCTCCAGGCCCATGGCGG - Intronic
1153329434 18:3858317-3858339 GTTCCCCTCTCCTCCCAGGTTGG + Intronic
1153356578 18:4143517-4143539 GTTCCCCTCTGGCCCAGGGAAGG + Intronic
1153748321 18:8203194-8203216 GTTACCCTCAAAGCCCAGAATGG - Intronic
1154299753 18:13182765-13182787 GTCCCCCTCTAGGCTCAGATGGG - Intergenic
1155506135 18:26535128-26535150 GTTTACCTCTTGGCACAGGATGG - Intronic
1156416625 18:36900322-36900344 GTTCCCTACAAGGCCCATGATGG + Intronic
1156480347 18:37432336-37432358 CTCCCCCTCTGGGCCCAGGTGGG - Intronic
1157189101 18:45565764-45565786 GTGCCCTTCTAGGCACAGGAAGG + Intronic
1158951461 18:62499260-62499282 GTGCACCTCTGGGCCCAAGAAGG - Intergenic
1161099954 19:2416579-2416601 GCTCCCGCCCAGGCCCAGGAGGG - Exonic
1162948018 19:14055143-14055165 GTCCCCCTCTGAGCCCAGGGAGG - Exonic
1163023350 19:14495654-14495676 GTCCCCCCCAAGGCCCTGGAGGG + Intronic
1163277531 19:16294713-16294735 GTTTCCCTCTTTGCCCAGGCTGG - Intergenic
1163674096 19:18646725-18646747 GATCCCCTCAAGGCCCATGCGGG - Intronic
1167107515 19:47438952-47438974 GTTCAGCTCTTTGCCCAGGAAGG - Intronic
1168191976 19:54745389-54745411 GTTTCCCTCTGTGCCCAGGCTGG + Intronic
1168194262 19:54761946-54761968 GTTTCCCTCTGTGCCCAGGCTGG + Intronic
1168204666 19:54840922-54840944 GTTTCCCTCTGTGCCCAGGCTGG + Intronic
925266015 2:2566836-2566858 CTTCCCATCTAGGCCCAGGCCGG - Intergenic
926217515 2:10914460-10914482 CTCCCCCTGCAGGCCCAGGATGG + Intergenic
926797285 2:16629299-16629321 CTTCCCCACTAGGCCCAGTCAGG - Intronic
929239966 2:39643957-39643979 GTCTCGCTCTTGGCCCAGGATGG + Intergenic
937074190 2:119089119-119089141 GTTCCCTGCTACCCCCAGGAGGG - Intergenic
940503769 2:154527290-154527312 GCTCTCCTCTAGCCCAAGGAAGG + Intergenic
942706641 2:178780827-178780849 GTTGCCTTCCAGGCCCAGGCAGG - Intronic
942768184 2:179482432-179482454 CTGCCCCTCTGGGCCCATGACGG - Intronic
944362967 2:198880209-198880231 TTTCCCATCTAGTCCTAGGATGG - Intergenic
945648678 2:212534357-212534379 TTTCCCCTCTTGACCAAGGAAGG - Intronic
946361730 2:219223027-219223049 GTGCCCCCCCAGACCCAGGAGGG + Intronic
946459204 2:219854165-219854187 TTTCCCTTCTGGGTCCAGGAAGG - Intergenic
947169319 2:227295278-227295300 GGGCCCCTCCAGGCCCAAGAGGG + Exonic
948615866 2:239198411-239198433 CTCACCCTCTAGTCCCAGGATGG - Intronic
1170996459 20:21364609-21364631 TTTCCCCACATGGCCCAGGATGG - Intronic
1173903647 20:46609851-46609873 ATTCTCCTATAGGTCCAGGAGGG - Intronic
1173944712 20:46941308-46941330 GTTTCCCTCAAGGTCTAGGAGGG + Intronic
1174219018 20:48937360-48937382 CTTCTCCACTAGGCCCAGTAGGG - Intronic
1174487967 20:50873067-50873089 TTTCCCCTCTGTGACCAGGAAGG + Intronic
1174723529 20:52838338-52838360 GGTCTCCTCTAAGCACAGGATGG + Intergenic
1175893470 20:62325541-62325563 GTTCCCCTGTGGGTCCAGGATGG + Exonic
1176094873 20:63336047-63336069 TTTCCCCTCTTGCCTCAGGAAGG - Intergenic
1179395945 21:41040083-41040105 GCTCCCCTCTAGCCCAGGGAGGG - Intergenic
1183542069 22:38435246-38435268 CTCCCCATCTAGGCCCAGGAGGG - Intronic
949802883 3:7922621-7922643 TTTTCCCTTTAGGCCCAGCATGG - Intergenic
949916011 3:8965148-8965170 GCCCACCTCTAGGCCCAGGAAGG + Intergenic
950124839 3:10504857-10504879 GGTCCCCTCCATGGCCAGGAGGG - Intronic
950766867 3:15279493-15279515 GTTCCCCTTTAAGCTCAGGCTGG - Intronic
950788326 3:15453574-15453596 GCTCCCCTCTGGGCCTTGGATGG + Intronic
954140729 3:48603807-48603829 GTTGCCCTCTGGGCCCTGGAGGG - Intronic
961317576 3:126050979-126051001 GTTCCCCTTCAGGCCCACCAGGG + Exonic
961318575 3:126057047-126057069 GTTCCCCTCCTGGCAGAGGAGGG + Intronic
961986248 3:131138152-131138174 GTTCCCCTCTGGCCCAGGGAAGG - Intronic
966597439 3:181737179-181737201 GCTCCACCCTAGGACCAGGAAGG - Intergenic
968067882 3:195768922-195768944 GTTCCCGCCTTGCCCCAGGATGG + Intronic
968286112 3:197509926-197509948 GTCCCCCTCTGGGCTCTGGAGGG + Exonic
969215345 4:5717646-5717668 GTTTCTCTCTATGCCCAGCATGG + Intronic
972043940 4:34639813-34639835 ATCCTCCTCTAAGCCCAGGAAGG - Intergenic
972675746 4:41257720-41257742 TTTCCCCTCACGGCCCAGGTAGG + Exonic
973790734 4:54375805-54375827 TTTCACCTGTAGACCCAGGAGGG + Intergenic
973982077 4:56315361-56315383 CTTCTCCTCCAAGCCCAGGAGGG - Exonic
976128721 4:81860812-81860834 GTTCCCCTCTAGCCCAGGGCAGG - Intronic
976372781 4:84309365-84309387 TTTCACCTCTAGGTCCAAGAGGG - Intergenic
982617154 4:157653198-157653220 TTTCTCCTCTATGCCCAGGAGGG + Intergenic
988768687 5:34409140-34409162 GTGCCCCTCTGGGCTTAGGAGGG + Intergenic
990125149 5:52507642-52507664 TTTCCCCTCAAGAACCAGGAAGG - Intergenic
994292975 5:98051416-98051438 TTTCCCCTCCTGGCCAAGGATGG - Intergenic
998695246 5:144631002-144631024 GTACTCCTCATGGCCCAGGATGG + Intergenic
1002177514 5:177409617-177409639 GTGCCCCACCAGGCTCAGGAGGG - Intronic
1002569848 5:180134114-180134136 GTTCCCCTCCTGGCGCAGAATGG - Intronic
1002634130 5:180598765-180598787 GTCCCCCACTGGGCCCAGGAAGG + Intergenic
1005988216 6:30887085-30887107 ATAGCCCTCTAGGCCCAGGGTGG - Intronic
1006097596 6:31665717-31665739 GTTCCCCTCTAGTCCCGGCGCGG - Intronic
1006631503 6:35433420-35433442 GTCTCCCTCTATGCCCAGGCTGG - Intergenic
1007408819 6:41649822-41649844 ATCCCCCTCCAGGCACAGGAAGG + Exonic
1008657114 6:53627369-53627391 GTTTCCCTCTGAGCCCATGATGG + Intergenic
1009241920 6:61194787-61194809 TTTCCTCTCTAGGACCAGAATGG - Intergenic
1014490240 6:122053559-122053581 GTTCACCTCTAGGGCTGGGAGGG - Intergenic
1016156667 6:140819056-140819078 TTTCCTCTCTAGACCCAGGAGGG - Intergenic
1020177554 7:5895179-5895201 GTTCCCCTCTGGGTCCAGCATGG - Intergenic
1020305362 7:6829767-6829789 GTTCCCCTCTGGGTCAAGCATGG + Intergenic
1022443066 7:30449545-30449567 TTTCCCATCTTGGCCCAAGAGGG - Intronic
1024310216 7:47962296-47962318 GTTCCCTGCTGGGCCAAGGAAGG + Intronic
1026767815 7:73171599-73171621 GTACCCCTGTAGTCCCAGGGAGG - Intergenic
1027044281 7:74981307-74981329 GTACCCCTGTAGTCCCAGGGAGG - Intronic
1027079360 7:75221051-75221073 GTACCCCTGTAGTCCCAGGGAGG + Intergenic
1029081286 7:97975822-97975844 GTTCCCCTCTGGGTCCAGCATGG + Intergenic
1029797290 7:102909299-102909321 GTTCCCCTCTGGCCCAAGGCAGG + Intronic
1030273678 7:107696795-107696817 GTTCCCCTCTAGGCCCAGGAGGG - Intronic
1031472447 7:122182837-122182859 ACTCCCCTCTAGCCCCAGGCAGG - Intergenic
1035397292 7:158543380-158543402 GTGCCCCTCTAGTCCTTGGATGG + Intronic
1038356209 8:26831739-26831761 GTTCCCCCCAAGGCCCAAAAGGG - Intronic
1042980276 8:74518925-74518947 GCTCCCCTCTAGCCCAAGGAAGG - Intergenic
1048015446 8:130492429-130492451 CCTCCCCTCTGTGCCCAGGATGG + Intergenic
1048881630 8:138876879-138876901 CTTCTCCTCCAGGCCCGGGAGGG - Intronic
1049385458 8:142340871-142340893 CTTCCCCTCTGGGCCCAGGGAGG - Intronic
1049585750 8:143431578-143431600 GTCCCACTCCAGGCCCAGCAAGG - Intergenic
1050616617 9:7407978-7408000 ATTCCCCTCTCACCCCAGGATGG + Intergenic
1052665259 9:31487392-31487414 CTTCCACTCCTGGCCCAGGAAGG + Intergenic
1055147917 9:72958699-72958721 ACTGCCCTCTAGGCCCAGAATGG - Intronic
1055785660 9:79866509-79866531 ATTCTACTCTAGGCCCAGGGGGG + Intergenic
1056402238 9:86239607-86239629 TTACCCCTCTAGCCCCAGGCAGG - Intronic
1056604841 9:88077420-88077442 GATCCCAGCCAGGCCCAGGAGGG - Intergenic
1060940028 9:127537891-127537913 GTTCCCTTCTTAGCCCAAGAGGG + Intronic
1061879080 9:133559713-133559735 CTTCCCCTTGAGCCCCAGGATGG + Intronic
1061956132 9:133962152-133962174 ATCCCCCTCTGTGCCCAGGAGGG - Intronic
1187125541 X:16451175-16451197 CTTCTCCTCTTGGCCCAGCATGG - Intergenic
1188350344 X:29122532-29122554 GTTTCCCTTTAGGCTCATGATGG - Intronic
1188507006 X:30893562-30893584 GTTACCCTTCAGGCCCAGCAAGG - Intronic
1193196601 X:78639540-78639562 GTTCCCCTCCAGGCTAGGGAGGG - Intergenic
1193830972 X:86289140-86289162 GTTTCCCTTATGGCCCAGGATGG + Intronic
1196270044 X:113699547-113699569 GCTCCCCTCTAGCCCAAGGCAGG + Intergenic
1197391881 X:125877789-125877811 GTCCCCCTCTGGCCCAAGGAAGG + Intergenic
1200088981 X:153625636-153625658 GTTCTCCTCTTGTCCCAGGCTGG + Intergenic
1200144924 X:153921523-153921545 GTGCCCCTCTACCCCCAGGAAGG - Exonic
1202387601 Y:24340463-24340485 GCTCCCCTCATGGCCCTGGAGGG + Intergenic
1202483185 Y:25329665-25329687 GCTCCCCTCATGGCCCTGGAGGG - Intergenic