ID: 1030274102

View in Genome Browser
Species Human (GRCh38)
Location 7:107701044-107701066
Sequence TGGCACCTAAAGCTTATTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 72}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030274102_1030274105 12 Left 1030274102 7:107701044-107701066 CCATTAATAAGCTTTAGGTGCCA 0: 1
1: 0
2: 2
3: 8
4: 72
Right 1030274105 7:107701079-107701101 AACTTGACATTTATTTCCAAAGG 0: 1
1: 0
2: 3
3: 33
4: 313
1030274102_1030274106 16 Left 1030274102 7:107701044-107701066 CCATTAATAAGCTTTAGGTGCCA 0: 1
1: 0
2: 2
3: 8
4: 72
Right 1030274106 7:107701083-107701105 TGACATTTATTTCCAAAGGTTGG 0: 1
1: 0
2: 2
3: 23
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030274102 Original CRISPR TGGCACCTAAAGCTTATTAA TGG (reversed) Intronic
909921848 1:81391601-81391623 GGGCACCTAAAGATAAATAAAGG - Intronic
910551038 1:88475567-88475589 TGGCACCCAAAACTTTTTGAAGG - Intergenic
913156854 1:116108199-116108221 TGGTACCAAAAGCTCCTTAAAGG - Intergenic
917721177 1:177787898-177787920 TGGCACATTAATCTTATTAATGG - Intergenic
1064498484 10:15941527-15941549 TGGGACCTAAAGCTTATTCAGGG + Intergenic
1068780795 10:60917383-60917405 TGGCAGCTGAAGCTGACTAAGGG - Intronic
1072046052 10:91656225-91656247 TGGCCACCATAGCTTATTAATGG - Intergenic
1078643851 11:13120140-13120162 TGTCACCTAGAGCTTAATGAAGG - Intergenic
1080281504 11:30562646-30562668 AGGCACCTACAGCTTATTAAGGG + Intronic
1085185276 11:74570737-74570759 TGGCACCTAAATCCTACTGAAGG - Intronic
1088445931 11:109928503-109928525 TGGCACCTAACCCTTCTTGAAGG - Intergenic
1090500762 11:127258364-127258386 TGGCAGCTACAGCTAAATAATGG - Intergenic
1092841700 12:12548725-12548747 TGACACCTTTAGATTATTAAAGG - Intronic
1093850063 12:24025609-24025631 TGGTACCTAATGCTTATTACAGG + Intergenic
1095455919 12:42385631-42385653 TAGCACATTATGCTTATTAAAGG - Intronic
1097615799 12:61882226-61882248 TGGCACATAAAGATTATAATTGG + Intronic
1097658007 12:62393276-62393298 TGGCACCTGATGTTTACTAAAGG - Intronic
1101448912 12:104758621-104758643 TGTCACATAAAGCTTTTTGAGGG - Exonic
1104578707 12:129992896-129992918 TAGCACCAAAATCTGATTAACGG + Intergenic
1107612034 13:42124869-42124891 TGCCACATGAAGCTTATTAAGGG + Intronic
1112117684 13:96374946-96374968 TGGCATGAAAAGCTTATGAATGG - Intronic
1117111496 14:52461573-52461595 TGGCACCTGATGCCTATAAAAGG + Intronic
1124397495 15:29316643-29316665 TGGCAGCTATAGCTGAGTAATGG + Intronic
1126756640 15:51931687-51931709 TAGAACCTTAAGCTTTTTAAAGG - Intronic
1129634933 15:77305413-77305435 TAGCAGCTAAAGGATATTAAGGG + Intronic
1132534416 16:470922-470944 TGGTACCTAACACTTTTTAAAGG + Intronic
1133236136 16:4388249-4388271 TGTCACCTAAGGGTTCTTAAAGG - Intronic
1140026037 16:71290938-71290960 TGACACATACAGCCTATTAATGG - Intergenic
1141840998 16:86573954-86573976 TGTCACCTGAATCTTAGTAAGGG - Intergenic
1155835960 18:30584347-30584369 TTGAACCTATACCTTATTAAAGG + Intergenic
1156194954 18:34764154-34764176 TGGCACATGAAGCCTCTTAAGGG + Intronic
1157886356 18:51370486-51370508 TAACACGTACAGCTTATTAAAGG - Intergenic
1166441608 19:42820392-42820414 AGGCACCTCAAACTTATTTAAGG + Intronic
1166449745 19:42888382-42888404 AGGCACCTGAAACTTATTTAAGG + Intronic
1166461045 19:42988680-42988702 AGGCACCTGAAACTTATTTAAGG + Intronic
930308588 2:49708907-49708929 TGGCACCTAATGCTAATCAAAGG - Intergenic
932157963 2:69435523-69435545 TGGCATATAAAGATTATTGAAGG - Intronic
938487932 2:131733637-131733659 TGGCACATAAAGAATATTCATGG - Intronic
938754185 2:134364631-134364653 CAGCACCTAAAGATTATAAAAGG + Intronic
940319414 2:152360124-152360146 TTGCAACTAAAGCATAATAAAGG + Intronic
940554246 2:155203114-155203136 TGGAAAGTTAAGCTTATTAATGG + Intergenic
942237300 2:173923817-173923839 TGGCAGGTGAAGCTGATTAAAGG - Intronic
948843055 2:240667253-240667275 TGAAACCAAAAGCTTTTTAAAGG - Intergenic
1169810127 20:9601401-9601423 TAGCACATAAAGATTAATAAAGG - Intronic
1173018000 20:39244230-39244252 TGGCACTGAAAGCTTATTCCAGG + Intergenic
1175557132 20:59872841-59872863 TTGTAACTAAAGTTTATTAAAGG - Intronic
1181843312 22:25684400-25684422 TGGCATCTATAGCTTAATTAGGG + Intronic
949908834 3:8882995-8883017 TTGCACTTAAAGCCTATTGAAGG - Intronic
951693880 3:25426081-25426103 TGGCTCCAAATGCTTATTTAAGG - Intronic
951898930 3:27637657-27637679 TGGCACCTTGAGGTTATAAAAGG + Intergenic
952487989 3:33835380-33835402 TAGCAATTAAAACTTATTAAAGG - Intronic
956035696 3:65088897-65088919 TCAAACCTAAAGCTTATTCAGGG - Intergenic
958814372 3:98900721-98900743 TAGCATCTTAAGCCTATTAAAGG - Intronic
959943865 3:112107191-112107213 TGGGCCCTAAAGATTAATAAAGG + Intronic
960200909 3:114835126-114835148 TGACACCTAAAGCTTGCTAAAGG + Intronic
976490826 4:85667930-85667952 TGACACCTAAAAATTATTTATGG + Intronic
979802203 4:124924534-124924556 TGACATCTAAATGTTATTAAAGG + Intergenic
980919033 4:139063978-139064000 TGGCACCTAGAGGTTATGAAGGG - Intronic
984864375 4:184269191-184269213 TATCACCTAAAGCTGAATAAAGG - Intergenic
989180369 5:38570273-38570295 TGGTACCTAAAGATTATTAGGGG + Intronic
991139163 5:63218978-63219000 TGGCATCTAAACATAATTAATGG - Intergenic
998528058 5:142860529-142860551 TGGCACCTGGAGCTGATGAATGG - Intronic
999260562 5:150236013-150236035 GGGCACATATGGCTTATTAATGG - Intronic
999941767 5:156550819-156550841 TGGGACATAATGCTTTTTAAAGG + Intronic
1003901274 6:10658163-10658185 GGGCACCTAAAAATTATGAAGGG - Intergenic
1008465347 6:51823968-51823990 TGACCCCTAAAATTTATTAAAGG - Intronic
1010480994 6:76354025-76354047 AGGCACCAAAAGCTTATTGAAGG - Intergenic
1013158192 6:107514370-107514392 TGGCACCTGAAACTTAATATAGG + Intronic
1014767606 6:125424641-125424663 TGGCTCATAAAGCTTATTTTGGG + Intergenic
1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG + Intronic
1023726228 7:43145226-43145248 TGGCCCCTTAAGATGATTAATGG + Intronic
1030274102 7:107701044-107701066 TGGCACCTAAAGCTTATTAATGG - Intronic
1030583937 7:111393139-111393161 TGCAACCTGAAGCTTTTTAAGGG + Intronic
1034089877 7:148353886-148353908 AGACACCAAAAACTTATTAATGG - Intronic
1039956647 8:42212504-42212526 AGGAACCTATAGCTTATCAAAGG - Intergenic
1041586701 8:59529116-59529138 TGGCACATAAAGCCTATCCAAGG + Intergenic
1041781719 8:61584571-61584593 TGGCACAAAAAGCTTATTTGGGG - Intronic
1057442470 9:95092033-95092055 TGGCACCAAAAGCCTGTTGAAGG + Intergenic
1058920878 9:109613545-109613567 AGGCACCTAAGGCATATAAAGGG - Intergenic
1188270651 X:28136311-28136333 TAGGACCTAAAGCTTGATAAAGG - Intergenic
1192128170 X:68522014-68522036 GGGCATCTGAAGCTTATCAAAGG - Intronic
1192877214 X:75243964-75243986 TGGCACATAATGCAAATTAAAGG - Intergenic
1197272036 X:124435337-124435359 TGGCACCTAAAGCAATTTACAGG + Intronic