ID: 1030274358

View in Genome Browser
Species Human (GRCh38)
Location 7:107703879-107703901
Sequence TGTTACTCATTGGGAGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030274358_1030274361 10 Left 1030274358 7:107703879-107703901 CCAGTTTCTCCCAATGAGTAACA 0: 1
1: 0
2: 0
3: 19
4: 189
Right 1030274361 7:107703912-107703934 CTGTAGCATAAAATCACAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030274358 Original CRISPR TGTTACTCATTGGGAGAAAC TGG (reversed) Intronic
905033402 1:34902450-34902472 TGGTACCCAGTGGGAGAAACAGG + Intronic
906196938 1:43935517-43935539 TGTTCCTCACCTGGAGAAACTGG + Intronic
906799766 1:48726304-48726326 TGTTACTCACAGAGAGAAAAGGG + Intronic
908425291 1:64001532-64001554 TGTTAACTATTGGGAGAAACTGG + Intronic
915241769 1:154527939-154527961 TGTTACCACTGGGGAGAAACTGG - Intronic
916388477 1:164304367-164304389 GGTTTCTCATGGGAAGAAACAGG + Intergenic
917179178 1:172275717-172275739 TGCTACTCCTTTGGAGAACCTGG + Intronic
918301043 1:183204116-183204138 TGTTACTTTTTGGTAGAGACAGG - Intronic
920217403 1:204370692-204370714 TTCTCCTCAGTGGGAGAAACAGG + Intronic
921600616 1:217102761-217102783 TCTTACTCTTTGGGAGACACTGG + Intronic
921644225 1:217594882-217594904 AGTTATACATTGGGAGAAATAGG + Intronic
921830079 1:219718314-219718336 TTGTACTTAGTGGGAGAAACAGG - Intronic
924209074 1:241746164-241746186 TGTTGCTGATGGGGAGAACCTGG + Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1063417512 10:5886214-5886236 TGTTTCTCCAGGGGAGAAACTGG + Intronic
1067776666 10:49169250-49169272 TGTTTCCCTTTGTGAGAAACAGG - Intronic
1070865441 10:79705811-79705833 TGTTACTTCTTGGGAGACAGGGG + Intronic
1070879235 10:79843942-79843964 TGTTACTTCTTGGGAGACAGGGG + Intronic
1071019689 10:81037418-81037440 TGTTAATAATAGGGGGAAACAGG + Intergenic
1071632341 10:87228032-87228054 TGTTACTTCTTGGGAGACAGGGG + Intronic
1071645794 10:87360250-87360272 TGTTACTTCTTGGGAGACAGGGG + Intronic
1072052633 10:91721763-91721785 TATTAACCATTGGGAAAAACTGG + Intergenic
1072430162 10:95364135-95364157 TCTTATTCATTTGGATAAACTGG + Intronic
1073728300 10:106260112-106260134 TGATACTCACTGTGAGAATCTGG - Intergenic
1074573818 10:114649811-114649833 TGTTACTCATTGGGGTGGACAGG - Intronic
1075023191 10:118966137-118966159 TGTTACTCAATGGGGGAAGGTGG + Intergenic
1079331704 11:19538823-19538845 TGTTACCCATTGGAGCAAACTGG - Intronic
1079523288 11:21354409-21354431 TTTCTCTCATTGGGTGAAACTGG + Intronic
1079937583 11:26636927-26636949 TCTTACTCCTTGTGAGAACCTGG - Intronic
1080088142 11:28311220-28311242 TCTTTCTCAGTGAGAGAAACAGG + Intronic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1086461469 11:87009897-87009919 TGTGATTCATTGGGAAAATCAGG + Intergenic
1089392443 11:118111368-118111390 TGTTACTCAGTGGGAGTGGCTGG + Intronic
1093060971 12:14603540-14603562 TCATACTCAATGGGGGAAACTGG - Intergenic
1093460327 12:19402153-19402175 AGTTACCCATGGGTAGAAACTGG + Intergenic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1095849398 12:46785408-46785430 TGTTACCCAGTGGTAGAATCTGG + Intronic
1096227781 12:49877461-49877483 TGTAACGCATTGCGAGAAATGGG + Intronic
1097448038 12:59698063-59698085 AATTATTCATTGGGAGAATCAGG + Intronic
1097655286 12:62353392-62353414 TGTTACACGTGGGGAGAGACAGG + Intronic
1098819879 12:75213862-75213884 AGTTAATAATTGGCAGAAACAGG + Intergenic
1102830230 12:115991484-115991506 TGGTCCTCATTGGAAGAATCGGG + Exonic
1103180408 12:118906401-118906423 TGTTACACCTTGGGAAACACTGG - Intergenic
1104358783 12:128112712-128112734 TGTTTCTGGTTGGGAGAAACAGG + Intergenic
1108382850 13:49870842-49870864 TGTTAATAATTGGGGGAAATGGG + Intergenic
1108421545 13:50254905-50254927 TCTTACTCTTTGGGAGCAACTGG + Intronic
1110360845 13:74623531-74623553 TGCTACTGAGTGGGAAAAACAGG + Intergenic
1111187415 13:84757047-84757069 TGATATTCATTGTGAGAAACTGG + Intergenic
1112770023 13:102784835-102784857 TACTACTCAGTGGAAGAAACTGG + Intronic
1113192576 13:107767158-107767180 TGTTTCATATGGGGAGAAACCGG + Intronic
1114170667 14:20269835-20269857 TGTTTCTCATTAGGTGGAACGGG - Intronic
1114405131 14:22449332-22449354 TGTTCTTCCTTGGGTGAAACTGG + Intergenic
1115133701 14:30084285-30084307 TCTTACTCATTGAGAGAACAAGG - Intronic
1117349711 14:54869386-54869408 TGTTAAACATCAGGAGAAACTGG + Intronic
1117598571 14:57349481-57349503 TGTGACTCATTGGGAATCACTGG + Intergenic
1118800669 14:69186543-69186565 TTTTACTCTTTTGTAGAAACGGG + Intergenic
1118971805 14:70643214-70643236 TGCTACACATAGTGAGAAACGGG - Intronic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1120102500 14:80461487-80461509 TTTTACTCAATGGGAGAACATGG - Intergenic
1120246500 14:82012095-82012117 TGTTAATCATGGGAAGTAACAGG - Intergenic
1121148427 14:91606948-91606970 TCTTTGTCTTTGGGAGAAACTGG + Intronic
1121580259 14:95024743-95024765 TGCTTCTCATTGGGAGAATCAGG + Intergenic
1128882173 15:71254003-71254025 TTTTACTCATTGAGAGAAAGGGG + Intronic
1129219362 15:74122459-74122481 TGCCTCTCATTGGGACAAACAGG + Intronic
1131730381 15:95273134-95273156 TGTTACTCAAAGGGAAAAAAAGG - Intergenic
1135740408 16:24970352-24970374 TGAGACTCCTTGGGAGAAAGTGG - Intronic
1137846649 16:51696322-51696344 TGTTAACCATTCGGAGACACAGG - Intergenic
1139209103 16:65058679-65058701 TGTAAAAAATTGGGAGAAACAGG + Intronic
1140350272 16:74255862-74255884 TGTTTCTCACTTGAAGAAACAGG + Intergenic
1141528025 16:84625603-84625625 TGTTTCACATTTTGAGAAACTGG - Intergenic
1143077504 17:4356966-4356988 TGTTAGCATTTGGGAGAAACTGG - Intronic
1144783875 17:17821345-17821367 TGTTTCTCAATGTGTGAAACGGG + Intronic
1146382802 17:32343704-32343726 TGTTACTGAATGGGAGATAGAGG - Intronic
1150425595 17:65074641-65074663 TATTTCTCATTGGAATAAACTGG + Intergenic
1151260859 17:72914998-72915020 TGTTTTTCATTGGGAAAAAATGG + Intronic
1153387755 18:4517814-4517836 TCTTGCTTATTGGGAGAGACAGG + Intergenic
1155110931 18:22713703-22713725 TGTTATTCACAGGGAGAGACTGG - Intergenic
1158330079 18:56352335-56352357 CCTTAGTCATTGGGAGAAGCAGG - Intergenic
1159872633 18:73775763-73775785 TTTTATTCATTGGGAAAAAAAGG + Intergenic
1159907369 18:74107730-74107752 TGATACTCACTGTGAGAACCAGG - Intronic
1160030354 18:75251817-75251839 TCTTACTCATTTGGAAAAGCTGG + Intronic
1164903111 19:31945048-31945070 TTTGTCTCCTTGGGAGAAACAGG + Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166900910 19:46062081-46062103 TGGAACTCCTTGGGAAAAACAGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
925521362 2:4749398-4749420 TGTTTCTCATTGGATGAATCTGG + Intergenic
926807786 2:16727379-16727401 TCTAACTCATTGGGTGACACAGG + Intergenic
927013601 2:18932350-18932372 TGTTAATAATTGGGAAAAATGGG - Intergenic
929361867 2:41101532-41101554 TGTTACCCAATAGGAGCAACTGG - Intergenic
929949610 2:46396671-46396693 TGTTAATCATAGAGAAAAACTGG + Intergenic
931543801 2:63358470-63358492 TCTTACTCTTTGGTAGAGACAGG + Intronic
934577534 2:95412530-95412552 TGTCACTCACTGGGAGACCCAGG - Exonic
934793823 2:97084159-97084181 TGTCACTCACTGGGAGACCCAGG + Exonic
938004955 2:127781546-127781568 TTGTTATCATTGGGAGAAACTGG + Intronic
939500174 2:142974597-142974619 AGTTACTCCTTGGGGGAAACTGG - Intronic
939585364 2:143997877-143997899 TGTTCCTCATTAGGAGAACTAGG - Intronic
939671886 2:145022847-145022869 TGGAACTCATTGCAAGAAACTGG + Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
943068424 2:183113489-183113511 ATGTAATCATTGGGAGAAACTGG + Intergenic
943281797 2:185944226-185944248 TGTGAATCATTGGGAGTTACAGG + Intergenic
946536769 2:220638573-220638595 TGTTAATCAGTGTGAGAAAAGGG + Intergenic
1173128663 20:40365604-40365626 TGTTCCTCAATGGGAGCACCAGG + Intergenic
1173301497 20:41807792-41807814 TGTTAACGATTAGGAGAAACTGG - Intergenic
1174073638 20:47916568-47916590 TGTTACACAGTGTGATAAACGGG + Intergenic
1175481109 20:59311725-59311747 TCTTACTCATTGGATGAGACGGG - Intronic
1179080293 21:38164541-38164563 TTTTATTCATTGGGTGAAATGGG + Intronic
1185269797 22:49924114-49924136 TGGAACTCTTTGGGAGAAACTGG - Intronic
951454985 3:22881406-22881428 TGTTACTTATTTAAAGAAACTGG - Intergenic
951637356 3:24794272-24794294 TGTTAACCATTGGGAGATATTGG - Intergenic
951812785 3:26719255-26719277 TGTTACTCTTTGAGAGGAAAGGG - Intergenic
952176547 3:30869968-30869990 TGTTTCTCAATGTGAGAAGCAGG + Intronic
952798466 3:37264992-37265014 TGTTACTACTGGGGAGAAATGGG - Intronic
953786449 3:45915204-45915226 TCTTTCTCATTGGAAGAAAGGGG - Intronic
955033817 3:55246858-55246880 TGTTACTCATGTAGAGAAACAGG - Intergenic
955480717 3:59386418-59386440 GATTACTCATTGGAAGAAAGAGG + Intergenic
955784184 3:62518936-62518958 TGTTACTCATTGTAATAAAAAGG + Intronic
955994334 3:64663825-64663847 TCTAACTCATTAGGAGAAAAAGG - Intronic
956268174 3:67421683-67421705 TAGTATTCATTGGGAGAAAGGGG + Intronic
958763596 3:98338650-98338672 TGATACTAATGTGGAGAAACTGG + Intergenic
959007193 3:101033569-101033591 TGTTACTCACTTGAGGAAACAGG - Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
964045575 3:152321326-152321348 TGTTACTCATTGAGACTTACTGG + Intronic
964355979 3:155852356-155852378 TTTTACTCATGCAGAGAAACAGG + Intronic
964410932 3:156397280-156397302 TGTTGCTTATTGGGAGTAAATGG + Intronic
965925665 3:173976395-173976417 TAAAACTCATTGGGAGTAACAGG + Intronic
968684099 4:1944898-1944920 TGTTTCTAGTTGGGAGATACAGG - Intronic
970995675 4:22265279-22265301 TGTAACTGAGTGGGAGATACTGG + Intergenic
974110386 4:57518954-57518976 TGATACTGAATGGGAAAAACTGG + Intergenic
974610123 4:64206114-64206136 TGGCTCTCATTGGGAGGAACGGG + Intergenic
975128085 4:70804470-70804492 TGTTACTCCTGGGGAGGGACTGG - Intronic
975662096 4:76698410-76698432 TGTCATTCATTGGGAAAAAATGG - Intronic
975930759 4:79519336-79519358 AGTTACTGAATGGGAAAAACTGG - Intergenic
976711089 4:88072503-88072525 TTTTGCTCATGGGGAGACACAGG - Intronic
977691812 4:99919753-99919775 TTGTACTCATTGGGAGAAATGGG + Intronic
978016488 4:103752469-103752491 TGTTACTCATTGTGTAACACTGG - Intergenic
979988937 4:127351086-127351108 TCTTACTGATTCTGAGAAACTGG + Intergenic
980540683 4:134189974-134189996 TGTTTTTCACTGTGAGAAACTGG + Intergenic
984185836 4:176542665-176542687 ACTTACTCATTGGTAGGAACTGG - Intergenic
984384768 4:179042044-179042066 TGTTAACCATTAGGAGAAGCTGG - Intergenic
986797335 5:11224744-11224766 TGTTAGTAAGTGGGAGAAACTGG - Intronic
991390810 5:66141642-66141664 TGTTATTGTTTGGTAGAAACGGG + Intronic
991966965 5:72102331-72102353 TGTTACTCACAGGAAGAGACAGG + Intergenic
992040564 5:72826653-72826675 TGTTACTCATTGTGATATATAGG - Intronic
992521947 5:77562898-77562920 TCTTACTTCTTGGGAGAATCAGG - Intronic
993344672 5:86768437-86768459 TGTTAAACAGTGGGAGAAAGTGG + Intergenic
995280942 5:110335033-110335055 TGTTACTCCTTGAGAGCAATGGG - Intronic
998373922 5:141679366-141679388 TGTGACTCAGTGGGACAGACAGG - Intronic
1001661736 5:173398357-173398379 TGTTCCTCCATGGGACAAACAGG + Intergenic
1003812072 6:9795463-9795485 TGTTACTCAGTGGAAAAAAATGG + Intronic
1003854261 6:10256265-10256287 TGATACTCATTATGAGAACCTGG - Intergenic
1005224043 6:23620407-23620429 TGTTATTCTATAGGAGAAACTGG - Intergenic
1005524183 6:26629803-26629825 TGGTTATCATTGGAAGAAACTGG - Intergenic
1006015673 6:31078776-31078798 TATTATTCAATGGGAGAATCTGG - Intergenic
1008077282 6:47158446-47158468 TGTTGCCAACTGGGAGAAACTGG + Intergenic
1009716783 6:67408063-67408085 TGGAACTCCTTGGGAAAAACAGG + Intergenic
1009873603 6:69478135-69478157 TTATGCTTATTGGGAGAAACTGG + Intergenic
1012026546 6:94001097-94001119 TGTTATTCTTTGGGAAAAAAAGG - Intergenic
1012330941 6:97986236-97986258 TGGTAACCATTGGGAGAAACTGG + Intergenic
1012837231 6:104284825-104284847 TTTTATTCAGTAGGAGAAACTGG + Intergenic
1013081231 6:106815229-106815251 TAAGACTCCTTGGGAGAAACAGG + Intergenic
1013720365 6:113019045-113019067 TGCTATTCACTGTGAGAAACTGG - Intergenic
1015350136 6:132209177-132209199 TCTTTCTCATTGAGAGACACTGG + Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015881793 6:137877363-137877385 TGTTTCCCATTGGCAGAAACTGG - Intronic
1016545343 6:145216396-145216418 TGCTACACATTGGGAGAAATAGG + Intergenic
1019762907 7:2826995-2827017 TGTTACTCACAGGGGAAAACTGG + Intronic
1020350549 7:7214286-7214308 TGGAACTCCTTGGGAAAAACAGG - Intronic
1021215586 7:17912300-17912322 TGTCAGTGTTTGGGAGAAACAGG - Intronic
1022211829 7:28218329-28218351 AGATACTCATTTTGAGAAACAGG - Intergenic
1023170047 7:37382319-37382341 TGTTACTATTTGGGAAATACGGG - Intronic
1027193730 7:76013654-76013676 GGTGACTGAGTGGGAGAAACAGG - Intronic
1028580657 7:92406463-92406485 AGGTACTCATTGGAGGAAACTGG + Intergenic
1029413275 7:100428690-100428712 TCTTCCTCATTGGCAGAAGCTGG + Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030274358 7:107703879-107703901 TGTTACTCATTGGGAGAAACTGG - Intronic
1031414010 7:121473974-121473996 TGTTTCTCCTTTGGAGAAATTGG + Intergenic
1031440018 7:121782620-121782642 CATTATTCATTGGGAGATACTGG + Intergenic
1031500635 7:122510792-122510814 AATTACCCATTGGGAGGAACTGG - Intronic
1031899070 7:127391016-127391038 TTGAACTCATTGGGAGAATCAGG - Intronic
1032063175 7:128742408-128742430 TGTTAACAATTGGGAGAAATGGG - Intronic
1035946260 8:3966480-3966502 ATTTATTTATTGGGAGAAACAGG + Intronic
1039599874 8:38827221-38827243 TGCTACTGATGAGGAGAAACTGG + Exonic
1040870829 8:52098871-52098893 TGGTAATCCTTGGGAGAAACAGG + Intergenic
1044133329 8:88554580-88554602 TGTTACTAATAGGCAGAAAATGG + Intergenic
1045437975 8:102183643-102183665 TGTTACGCACTGTGACAAACTGG - Intergenic
1045597974 8:103678314-103678336 TGCTAGTCACTGGGATAAACTGG + Intronic
1045748844 8:105457665-105457687 TGTTACTCATAGATAGAAAATGG + Intronic
1048760166 8:137785527-137785549 TAATAGTCATTTGGAGAAACTGG - Intergenic
1052740949 9:32392646-32392668 TGTTTCTCATTTGGGCAAACTGG - Intronic
1053730184 9:41046508-41046530 TGATACTCACTGGAAGCAACAGG - Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058528444 9:105883241-105883263 TGAGAGTCATTGGGAGACACGGG - Intergenic
1187090682 X:16093106-16093128 TACTACTCATATGGAGAAACAGG - Intergenic
1188697496 X:33213721-33213743 AGTTAATCTTTGGGAGAAACTGG - Intronic
1188859182 X:35236730-35236752 TGTTAACCATTAGAAGAAACTGG + Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1192380454 X:70611209-70611231 TTTTACTTGTTAGGAGAAACTGG - Intronic
1192489955 X:71567620-71567642 TGTTCCTCTTTAGGAGCAACAGG - Exonic
1193257017 X:79361273-79361295 TGTTACACAGTGGAAGAAAGTGG - Intronic
1193753319 X:85374613-85374635 TCATAGTCATTGGGAGTAACAGG - Intronic
1194295464 X:92121490-92121512 AATTACTCAATGGGAGTAACTGG - Intronic
1196056010 X:111355959-111355981 GGTGACTCATTTGGAGAAAATGG - Intronic
1197580644 X:128278945-128278967 TGTTACCCATTGGGGTTAACTGG + Intergenic
1198714576 X:139543387-139543409 TGTTACTCTTTAGAAGAGACAGG - Intronic
1200128157 X:153827887-153827909 TGTGAGTCATTGGCAGAAAATGG + Intronic
1200612965 Y:5345997-5346019 AATTACTCAATGGGAGTAACTGG - Intronic
1201427499 Y:13869223-13869245 TGTCACTCATTGGCAGACAGTGG + Intergenic