ID: 1030274495

View in Genome Browser
Species Human (GRCh38)
Location 7:107705516-107705538
Sequence GAAGACTTCTTGGTTAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030274495_1030274497 8 Left 1030274495 7:107705516-107705538 CCTGTTTTAACCAAGAAGTCTTC 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1030274497 7:107705547-107705569 ACCTGATGTATTTATATATGTGG 0: 1
1: 0
2: 1
3: 20
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030274495 Original CRISPR GAAGACTTCTTGGTTAAAAC AGG (reversed) Intronic
901173211 1:7279308-7279330 GATGACTTATTGGTTAAAATAGG + Intronic
901873211 1:12150718-12150740 GAAGACCTCCTGGTGAATACCGG + Intergenic
904413529 1:30340591-30340613 GAAGAGTTCTTTGCTGAAACTGG + Intergenic
908556482 1:65261754-65261776 GGAGCCTTCTTGATTAAAAAGGG + Intronic
908588123 1:65596979-65597001 GCAGAGTTCTTTGCTAAAACTGG - Intronic
908775558 1:67636314-67636336 AAAGACCTCTTGGTTTAAAGAGG + Intergenic
909118618 1:71572089-71572111 GATGATTTCTGGGTTTAAACGGG + Intronic
909136817 1:71811677-71811699 GAAAACTTCTTCTCTAAAACAGG - Intronic
909611031 1:77552033-77552055 GCAGAGTTCTTTGCTAAAACTGG - Intronic
911134789 1:94428031-94428053 GAAGCCTTCTTAGGTAAAATAGG + Intronic
911784358 1:101926472-101926494 AAAGACTTCTGTCTTAAAACAGG - Intronic
912210852 1:107555407-107555429 GAAGATTTCCTGTTTAAAATGGG + Intergenic
914040935 1:144049033-144049055 GAAAAGTTCTAGGTTAAAAAGGG + Intergenic
914137155 1:144911443-144911465 GAAAAGTTCTAGGTTAAAAAGGG - Intronic
915436861 1:155913400-155913422 GAAAACTTCTTGACTAAAACTGG - Exonic
916697366 1:167252785-167252807 GATAACTTCTTGTTTATAACAGG + Intronic
920487799 1:206387302-206387324 GAAAAGTTCTAGGTTAAAAAGGG + Intronic
922062909 1:222108628-222108650 GGTGACCTCTTGGTTAAATCTGG + Intergenic
923584356 1:235253028-235253050 GAAAACATCTTGTATAAAACAGG + Intronic
1068051046 10:51949720-51949742 GGAGACTTCTTGATTAAACAAGG - Intronic
1070018702 10:72561860-72561882 GAAGAGTTCTTTGTAAAATCTGG - Intronic
1070019660 10:72571558-72571580 GAAGAGATCATGGTAAAAACGGG + Intronic
1077388043 11:2283795-2283817 GAAGGCTTCTTTGTAGAAACTGG + Intergenic
1080016721 11:27515015-27515037 GAAGACTTCTTGGATTACAGGGG - Intergenic
1084687938 11:70708234-70708256 GATGACGTCTTGGGTATAACAGG - Intronic
1087230195 11:95652563-95652585 AAAGACTTCTTGTATAAAAAGGG - Intergenic
1087795155 11:102448695-102448717 GAAGAACTCAGGGTTAAAACAGG + Intronic
1088678734 11:112221358-112221380 GAAGAGTTCTTGGCTACAATGGG - Intronic
1090157494 11:124456860-124456882 GAAGACATCTTCTATAAAACTGG - Intergenic
1091307000 11:134542696-134542718 TCAGACTTCTGTGTTAAAACTGG - Intergenic
1091443933 12:532678-532700 GAAGAATTCTTGCTGAAAACTGG + Intronic
1092957203 12:13561729-13561751 GGAAAGTTCTTGGTTCAAACTGG + Exonic
1093881879 12:24414024-24414046 GAAGACTTCATGACTAAAAGGGG - Intergenic
1094099485 12:26745892-26745914 GAAGACTTCTTGGAAAAATGAGG - Intronic
1097269084 12:57763390-57763412 GGGGACTTCTTGGTTAATAAGGG + Intronic
1097897167 12:64836445-64836467 TAAGACTGCTTTGTAAAAACTGG - Intronic
1098878393 12:75891220-75891242 GCAGGATTCTTTGTTAAAACTGG - Intergenic
1104706665 12:130952510-130952532 GAATTCTTCCAGGTTAAAACTGG + Intergenic
1105991282 13:25624030-25624052 TAAGACTTCATGGTAGAAACTGG + Intronic
1106039594 13:26076823-26076845 GAAGACTTGGGGGTTAATACTGG + Intergenic
1109408573 13:61934833-61934855 GAAGACTTCATTGTTAAATGAGG - Intergenic
1110437993 13:75496626-75496648 GAAAACTTCTAGGTTCAAATAGG - Intergenic
1112095168 13:96124715-96124737 GAAAACTGCTTAGTTAAACCAGG - Intronic
1115385843 14:32795698-32795720 GAAGCATTCTTGTTAAAAACTGG + Intronic
1115441831 14:33444532-33444554 AAAGACATCTTGGTCTAAACTGG + Intronic
1115674112 14:35650066-35650088 GAAGGATTCTTGGCTAAAAATGG + Intronic
1115887365 14:37987628-37987650 GAAGACTTCATGGTAAAATTTGG + Intronic
1117690027 14:58297602-58297624 GGAGCCTTCTTAGTTAAGACAGG - Intronic
1121675512 14:95749359-95749381 GATGACTTCCAGGTTAAATCAGG + Intergenic
1128482463 15:68051662-68051684 GCAGGCTACTTGGTGAAAACAGG + Intergenic
1129924146 15:79347446-79347468 GAAGGATTCTTTGTGAAAACTGG + Intronic
1132137118 15:99352089-99352111 GCAGAGTTCTTTGCTAAAACTGG + Intronic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1138769601 16:59648169-59648191 TTAGACTTCTGGGTTAATACTGG - Intergenic
1139762546 16:69197642-69197664 GAATGCTACTTTGTTAAAACTGG - Intronic
1140278933 16:73536394-73536416 GATGACTTTTTGGGTAACACTGG - Intergenic
1142334828 16:89481182-89481204 GAAGACTTCATGGTGTTAACTGG - Intronic
1144755391 17:17677343-17677365 GAAGCCTCCCTGGTTAAAGCAGG + Intergenic
1147924201 17:43936497-43936519 GGAGAGTTCCTGGTTAAAAGAGG + Intergenic
1148426875 17:47606393-47606415 AAAGACTTCTGGGTCAAGACTGG - Intronic
1149207987 17:54270617-54270639 GCTGACTTCTTGGGTAAAATTGG - Intergenic
1151239165 17:72744352-72744374 GAAGACATCTTTGTCACAACTGG - Intronic
1153067768 18:1065983-1066005 GGAGACTTTTTGGTCAATACTGG + Intergenic
1155088031 18:22476582-22476604 GAAGAAACCTTGGATAAAACTGG + Intergenic
1158807202 18:60987945-60987967 TAAGACTCCTCAGTTAAAACAGG + Intergenic
1159084390 18:63771894-63771916 GAAGGCTTCATGGTTCAAAAAGG + Intronic
1160259932 18:77283139-77283161 GTAGAATTCTTGGTTAAGGCTGG - Intergenic
1165722147 19:38087065-38087087 GCAGGGTTCTTTGTTAAAACTGG + Intronic
1168490133 19:56802239-56802261 GTTGACTTCTTGGTCAACACAGG + Intronic
925039559 2:720723-720745 GAAGCCATCTTGTTTAACACAGG - Intergenic
925250516 2:2432777-2432799 GTAGTCTTCTTTGTTAATACAGG - Intergenic
925511425 2:4630126-4630148 GAAGAGTATTTGGTTAAAAACGG - Intergenic
931825058 2:65991763-65991785 GAAAACTTCTTGCTGAAAAAGGG - Intergenic
933350879 2:81150817-81150839 GAAGACTTCTTGCTAATCACTGG - Intergenic
936075129 2:109396971-109396993 GAAGCCTTCATGGGAAAAACGGG - Intronic
938569685 2:132551298-132551320 GAAGACTTCTTGGACATATCTGG - Intronic
940436410 2:153661238-153661260 CAAGAGTTCTTGGTTAACAGTGG + Intergenic
940852431 2:158701395-158701417 GAAGACAGCCTGGTTAAAACAGG - Intergenic
941768336 2:169323761-169323783 GATTACTTCTTGGCTAAAACTGG - Intronic
942701897 2:178720636-178720658 GAAGGCTTCTGGGTGAAAACAGG + Exonic
943115343 2:183662482-183662504 AAATACTTCTTGGTAAATACTGG + Intergenic
943606998 2:189987690-189987712 GAGGATTTCTTGGTTACATCTGG - Intronic
943709128 2:191070615-191070637 GAAGACTTCTTGGAATAAGCAGG - Intronic
944806361 2:203285362-203285384 GATGCCTTCTTTCTTAAAACTGG - Intronic
1169787989 20:9381121-9381143 GAAGCATTCTTGCTTAAAATAGG - Intronic
1170849070 20:19987325-19987347 GACCACTACTTGGTTAAAATAGG - Intronic
1174570521 20:51497955-51497977 GCATACTTCTTGATTAAAAAAGG + Intronic
1178241029 21:30900864-30900886 GCGGAGTTCTTGGCTAAAACTGG + Intergenic
1183994015 22:41620139-41620161 GAAGACTGCTTGGTGAATTCTGG + Intronic
1184314725 22:43676751-43676773 GCATACTTCTTGGTTTAAAATGG - Intronic
949273532 3:2249931-2249953 GCAGACATCCTGGTTAAAGCAGG - Intronic
951560663 3:23963279-23963301 AAGGACTTCATGGTTTAAACTGG - Intronic
952075064 3:29685938-29685960 GAAGACTTGTTGGTAAATATGGG - Intronic
952451552 3:33438771-33438793 GAGGACTTCTGGGTTAAAGCTGG - Intronic
952852971 3:37744272-37744294 GAGGGCTTCTTGGGGAAAACTGG - Intronic
957885263 3:86279894-86279916 AAAGACTTCTTTATTAAAACAGG - Intergenic
958882834 3:99692234-99692256 GAGGAGTTATTGATTAAAACTGG - Intronic
959107890 3:102086417-102086439 GAAGACTTAGTGATTAAAAATGG - Intergenic
962225035 3:133598786-133598808 GTAGTCTTCTTGTTTAAAAAGGG - Intronic
965442719 3:168735672-168735694 GAAGACAAGTTGGTTAAAATTGG + Intergenic
966165671 3:177013823-177013845 GTAGACTTCCTGGGTAAGACCGG - Intergenic
966431661 3:179837822-179837844 ACAGGCTGCTTGGTTAAAACAGG + Intronic
967311084 3:188106862-188106884 AAAGACATCTAGTTTAAAACTGG - Intergenic
970126835 4:12823248-12823270 ACAGGCTGCTTGGTTAAAACAGG + Intergenic
970292052 4:14583614-14583636 GAAGACTTCTTTGTTATCTCTGG - Intergenic
971907795 4:32750113-32750135 GAAGACCTATTGCATAAAACAGG + Intergenic
974365323 4:60940884-60940906 CAAGACTTCTTTATTAAAAATGG + Intergenic
979536876 4:121831750-121831772 GAAGAGTTCTTGGTTCTAAAAGG + Intronic
980175306 4:129337388-129337410 CAAGAATGTTTGGTTAAAACAGG + Intergenic
981362075 4:143858548-143858570 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
981372809 4:143979384-143979406 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
981381897 4:144082622-144082644 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
983429522 4:167630886-167630908 AAAGACTTCATGCCTAAAACAGG + Intergenic
984056813 4:174940695-174940717 GGGGTCTTCTTGCTTAAAACAGG + Intronic
984536206 4:180978856-180978878 GTAAAGTTCTTGGTTGAAACGGG + Intergenic
989109452 5:37893170-37893192 AAAGTCTTCTTGTTTACAACTGG + Intergenic
990692530 5:58379409-58379431 TGGGACTCCTTGGTTAAAACAGG + Intergenic
991654968 5:68894820-68894842 CTAGATTTCTTGGTTAAAGCAGG + Intergenic
994088729 5:95789046-95789068 GAAAACTTCTTGTGTAACACAGG - Intronic
999937202 5:156500460-156500482 TGAGACTTGTTTGTTAAAACAGG + Intronic
1000562539 5:162808849-162808871 GAAAACTTCTTGGTTTATATAGG + Intergenic
1003018586 6:2489516-2489538 GGACACTTTTTGGTTAAAATTGG + Intergenic
1004573391 6:16869675-16869697 GAAGAAATCTTAGTTAAAAATGG + Intergenic
1005714039 6:28530061-28530083 GAAGTCTTCTTGATAAATACAGG + Intronic
1006562403 6:34925001-34925023 GAAGACTAATTTTTTAAAACAGG + Intronic
1010477085 6:76301082-76301104 GAAGAATTCTTTTTGAAAACTGG - Intergenic
1010508825 6:76692122-76692144 GCAGAGTTCTTTGCTAAAACTGG + Intergenic
1011144891 6:84203162-84203184 GAACAATTCTTGGTAAGAACTGG + Intronic
1011255092 6:85412325-85412347 CAGGACTGCTGGGTTAAAACTGG + Intergenic
1012198323 6:96373404-96373426 GAACACTTCTTGAAGAAAACAGG + Intergenic
1014776557 6:125517707-125517729 GAATAAATCTTGATTAAAACAGG + Intergenic
1016083828 6:139887854-139887876 GAAGACTCATTGGTTAACCCAGG - Intergenic
1017373218 6:153736964-153736986 GAAGTCTTCTTTGTTTAATCTGG - Intergenic
1017972099 6:159321651-159321673 GAACATTTCTTGGTTGAAAAGGG - Intergenic
1018423562 6:163661108-163661130 GAAGAGTTCTTGGGTAGATCAGG - Intergenic
1020729775 7:11866666-11866688 TCAGACTTCTGGGTTAATACTGG + Intergenic
1022990038 7:35697626-35697648 GAAAACTTCCTGGCTTAAACAGG - Intergenic
1024871872 7:53972948-53972970 GAAGAGTTCTGGGATAAAGCAGG - Intergenic
1027340324 7:77200861-77200883 TAAGATTTCTTGTTTAAAAAGGG + Intronic
1027460771 7:78450582-78450604 GAAGACTGTGTGATTAAAACAGG + Intronic
1029199430 7:98828708-98828730 GAGGACATCTTTGCTAAAACTGG + Intergenic
1030274495 7:107705516-107705538 GAAGACTTCTTGGTTAAAACAGG - Intronic
1031861103 7:126981281-126981303 GAAGACTTGTTGCTTCAGACAGG - Intronic
1032377855 7:131441635-131441657 AAAGGTTTCTTGGTTTAAACTGG + Intronic
1034211610 7:149368466-149368488 GCAGAACTCTTGGCTAAAACTGG - Intergenic
1036092753 8:5686252-5686274 AAAGATTTCTTGTTTAAAAATGG + Intergenic
1037510310 8:19575923-19575945 AAAGACTTCTTCTTTAAAAAAGG + Intronic
1038331068 8:26609845-26609867 GCAGACTTTGTGGTCAAAACTGG + Intronic
1040052021 8:43024721-43024743 GACCACTTCTGTGTTAAAACTGG - Exonic
1040293508 8:46137452-46137474 GAGGACTTCTGGGATAAAAGAGG + Intergenic
1040784329 8:51147974-51147996 GAACTCTTCTTGGGTAAAAAGGG - Intergenic
1041760586 8:61362073-61362095 GCAGAGTTCTTTGCTAAAACTGG + Intronic
1042058672 8:64793615-64793637 GAAGACTTCTTACTTAGAACTGG - Intronic
1042305079 8:67322722-67322744 GAAGACTTTTCGGTAAAGACAGG - Intronic
1042709571 8:71701609-71701631 TAATATTTCTTTGTTAAAACTGG + Intergenic
1044882054 8:96733466-96733488 GAAAAGTTCATTGTTAAAACTGG - Intronic
1045496953 8:102717120-102717142 GGATAATTCTTGGTTACAACTGG + Intergenic
1046033479 8:108811953-108811975 GCAGGCTACTTGGTTAAAATGGG + Intergenic
1047606137 8:126476589-126476611 GAAGATTTCTTGGGAAAATCAGG - Intergenic
1048131490 8:131702560-131702582 GAAGGATTCTTGCATAAAACTGG + Intergenic
1048324179 8:133426327-133426349 GAAGCCTGTTAGGTTAAAACTGG + Intergenic
1050020846 9:1283151-1283173 GAAGACTTCTTGCTTGACACTGG + Intergenic
1055280922 9:74673788-74673810 GATTACTTCTTGGATAAAATTGG + Intronic
1056323335 9:85457233-85457255 GAAGGCTTCATGGTTAAAGTTGG - Intergenic
1057789910 9:98118106-98118128 GAAGACTTCTTGGAGACAAGTGG + Intronic
1058060687 9:100492689-100492711 GAAGACTGTTTGGTTACAAGGGG + Intronic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic
1195840527 X:109171769-109171791 GCAGACCTCTTGGTTAAAATGGG - Intergenic
1196078155 X:111600373-111600395 GAAGGGTTCTTTGCTAAAACTGG - Intergenic
1197748940 X:129952053-129952075 GAAGACTTCTTGGAGAAAGTAGG - Intergenic
1201756931 Y:17496544-17496566 AAAGACTTCATGACTAAAACAGG + Intergenic
1201844622 Y:18409440-18409462 AAAGACTTCATGACTAAAACAGG - Intergenic