ID: 1030274783

View in Genome Browser
Species Human (GRCh38)
Location 7:107709115-107709137
Sequence GTGAAATCAGGGATCTACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 42}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030274783_1030274788 -5 Left 1030274783 7:107709115-107709137 CCAGCGTAGATCCCTGATTTCAC 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1030274788 7:107709133-107709155 TTCACAGGGAGCACCACCACAGG 0: 1
1: 0
2: 0
3: 2
4: 118
1030274783_1030274790 10 Left 1030274783 7:107709115-107709137 CCAGCGTAGATCCCTGATTTCAC 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1030274790 7:107709148-107709170 ACCACAGGAAGAGTACCAGAAGG No data
1030274783_1030274793 26 Left 1030274783 7:107709115-107709137 CCAGCGTAGATCCCTGATTTCAC 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1030274793 7:107709164-107709186 CAGAAGGTTATGCCTCCTTGAGG 0: 1
1: 0
2: 2
3: 7
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030274783 Original CRISPR GTGAAATCAGGGATCTACGC TGG (reversed) Intronic
908599406 1:65722874-65722896 GTGAAATCAGGGAAATAAGCTGG - Intergenic
911572130 1:99530238-99530260 GTGAAAACACGGATCTCCTCAGG - Intergenic
915241070 1:154522189-154522211 GTGGTATCAGGGTTCTAGGCAGG + Intronic
1070535915 10:77377130-77377152 GGGAAAGAAGGGATCTACGCAGG + Intronic
1083088119 11:60170984-60171006 GTGAAATTAGGGATATATACAGG - Intergenic
1097274032 12:57799354-57799376 ATGAAATCAGAGAGCTAGGCAGG + Intronic
1108362535 13:49680199-49680221 GTCCAGTCAGGGATCTACCCTGG - Intronic
1108456039 13:50614667-50614689 GTGCCATCAGGGAGCTACTCAGG + Intronic
1109550649 13:63894795-63894817 GTGAACACAGGAATCTACTCTGG - Intergenic
1113589877 13:111491059-111491081 GAGAAACCAGGGATATACTCAGG - Intergenic
1114246576 14:20920048-20920070 GTGACAACAGGGATCAACGACGG + Intergenic
1115161527 14:30401822-30401844 GTGATTTCAGGGTTCTACGAGGG + Intergenic
1121829632 14:97038863-97038885 ATCAAATCAGGGATCTAGCCAGG - Intergenic
1128470764 15:67950473-67950495 GTGAAATCATGGATCACTGCAGG - Intergenic
1141599044 16:85114211-85114233 CCGAAATCAAGGATCTACGGAGG - Intergenic
1144222761 17:13114896-13114918 GTTGAATCAGGGATAAACGCTGG - Intergenic
1146172179 17:30642758-30642780 ATGAAATCATGGCTCTAGGCCGG + Intergenic
1146345631 17:32058783-32058805 ATGAAATCATGGCTCTAGGCCGG + Intergenic
1162990245 19:14297280-14297302 ATGAAATCATGGCTCTAGGCCGG - Intergenic
1164831313 19:31323254-31323276 TGGAACTCAGGGATCTACGGTGG - Intronic
1165729153 19:38133289-38133311 ATGAAATGATGGATCTAGGCAGG - Intronic
1167033253 19:46977605-46977627 GTGAACTCAGGGGTCTACCAGGG + Intronic
1168522159 19:57060972-57060994 GTGAATTGAGGGCTCTACGAAGG - Intergenic
1168552301 19:57306937-57306959 AAGAAATCAGGTATCTAGGCTGG + Intergenic
929822176 2:45282537-45282559 GTGAAAACAGGGAACTATGGAGG - Intergenic
946800494 2:223410734-223410756 CTGAAATCAGAGATTTATGCAGG + Intergenic
1174341168 20:49896601-49896623 GTGAAATAATGGATCTAAGTGGG + Intergenic
1181359493 22:22323630-22323652 TAGAAATCAGGAATCTACTCAGG + Intergenic
957469388 3:80638804-80638826 GTGAAATTCGGGATCTTTGCAGG - Intergenic
970745368 4:19288408-19288430 GAGAAATAAGGCATCTAGGCCGG + Intergenic
972978858 4:44671072-44671094 CTGAAATCTGGGATCTAGTCAGG - Intronic
975663942 4:76715386-76715408 GAGAATGCAGGGATCTAAGCGGG - Intronic
991089561 5:62680793-62680815 CTGCATTCAGGGATCTAGGCTGG - Intergenic
992134291 5:73727723-73727745 TTGAAATCAGGGATTTATTCTGG - Intronic
997408732 5:133673537-133673559 GTCAAATTAGGGATCTGAGCTGG - Intergenic
998116720 5:139543449-139543471 GTGCAATCCAGGATCTACGTGGG - Intronic
1002932516 6:1644216-1644238 GTGGAATCAGGGGTCTCCCCTGG - Intronic
1006604385 6:35245521-35245543 GTGAAGTTAGGGATCTATGAGGG + Intronic
1014320623 6:119924306-119924328 CTGAAATCAGGGAACTATTCTGG - Intergenic
1016848941 6:148597035-148597057 GTGAAATCTGGGAGCTCCTCTGG - Intergenic
1021774772 7:24042016-24042038 GTGAAATCAGTGTTCTATTCAGG + Intergenic
1029577888 7:101415708-101415730 TTGAGATCAGGGATCAAGGCTGG - Intronic
1030274783 7:107709115-107709137 GTGAAATCAGGGATCTACGCTGG - Intronic
1040325433 8:46339208-46339230 GTGAAAACAGGGATGTACGGTGG + Intergenic
1046470494 8:114667473-114667495 GGAAAAACAGGGACCTACGCAGG + Intergenic
1195724494 X:107900195-107900217 GTGAAATGAGGGAGCTAGGGTGG - Intronic