ID: 1030275921

View in Genome Browser
Species Human (GRCh38)
Location 7:107721682-107721704
Sequence GCCAGCCACATGGTGTAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030275911_1030275921 24 Left 1030275911 7:107721635-107721657 CCAGCCCTTCTTCTGCATAATAA No data
Right 1030275921 7:107721682-107721704 GCCAGCCACATGGTGTAAGGAGG No data
1030275914_1030275921 19 Left 1030275914 7:107721640-107721662 CCTTCTTCTGCATAATAAGTGGC No data
Right 1030275921 7:107721682-107721704 GCCAGCCACATGGTGTAAGGAGG No data
1030275909_1030275921 26 Left 1030275909 7:107721633-107721655 CCCCAGCCCTTCTTCTGCATAAT No data
Right 1030275921 7:107721682-107721704 GCCAGCCACATGGTGTAAGGAGG No data
1030275912_1030275921 20 Left 1030275912 7:107721639-107721661 CCCTTCTTCTGCATAATAAGTGG No data
Right 1030275921 7:107721682-107721704 GCCAGCCACATGGTGTAAGGAGG No data
1030275917_1030275921 -7 Left 1030275917 7:107721666-107721688 CCTAACCAGAGGCAGAGCCAGCC No data
Right 1030275921 7:107721682-107721704 GCCAGCCACATGGTGTAAGGAGG No data
1030275910_1030275921 25 Left 1030275910 7:107721634-107721656 CCCAGCCCTTCTTCTGCATAATA No data
Right 1030275921 7:107721682-107721704 GCCAGCCACATGGTGTAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030275921 Original CRISPR GCCAGCCACATGGTGTAAGG AGG Intergenic
No off target data available for this crispr