ID: 1030282456

View in Genome Browser
Species Human (GRCh38)
Location 7:107791001-107791023
Sequence CAAGATGAACAGATTGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 205}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030282456 Original CRISPR CAAGATGAACAGATTGAGGT GGG Intronic
900502651 1:3014077-3014099 CAAGATGAGGTCATTGAGGTGGG + Intergenic
900795942 1:4708470-4708492 CATGATGAACAGATTTCGGGAGG - Intronic
901158104 1:7154225-7154247 GAAGATGAACAGATTGACCCTGG + Intronic
906267656 1:44445713-44445735 CAAGATGGAGGGATTGAGGCGGG - Intronic
906390441 1:45410885-45410907 AAAGACAAACAGCTTGAGGTTGG - Intronic
907701006 1:56788384-56788406 CAACAAGATCAGATTGTGGTGGG + Intronic
910180978 1:84482802-84482824 TATGAGGAACAGATTGAGTTTGG + Intronic
910298815 1:85682318-85682340 TAAGATGAACAAAATGAGGCCGG - Intronic
910564789 1:88631290-88631312 CAACAGGAACAGATTCAGGTGGG + Intergenic
915198571 1:154209165-154209187 CAAGATGAAAATGTGGAGGTTGG - Intronic
915543912 1:156585141-156585163 GAAGATGAAGAGTTTGAGGAGGG + Exonic
915645074 1:157264745-157264767 AGAGATGAACAGAATGAGGACGG + Intergenic
915725725 1:158015812-158015834 CAAGAGAAATAAATTGAGGTTGG - Intronic
915727772 1:158030912-158030934 CAGGATGAGCAGATGGAGCTGGG - Intronic
915913902 1:159930102-159930124 CAAGATGAGAAGATAGAGTTTGG + Intronic
916519664 1:165552335-165552357 AAAGATGAGCAAACTGAGGTTGG - Intronic
918604622 1:186407746-186407768 TAAAATGAACAGCTTAAGGTAGG - Intronic
920873335 1:209812314-209812336 CAAGCTGTAGAAATTGAGGTGGG - Intergenic
1063357769 10:5417186-5417208 CAAGAGGAACACATCGACGTGGG - Intronic
1065682580 10:28252086-28252108 CAAAATGAAAAGATTGATTTTGG - Intronic
1067243458 10:44516544-44516566 CATCACAAACAGATTGAGGTGGG + Intergenic
1067721636 10:48731936-48731958 CAAAGTGAACAGAGTGAGCTAGG - Intronic
1072101319 10:92232014-92232036 CAATATGAAAAGTTTGAGGCTGG - Intronic
1073023533 10:100468253-100468275 CTAGGTGAACAGCTTAAGGTTGG - Intronic
1073979687 10:109140886-109140908 CAGGATGAAGAGAGGGAGGTGGG + Intergenic
1074632830 10:115277582-115277604 CAAAACAAAAAGATTGAGGTGGG + Intronic
1075322721 10:121505103-121505125 CCAGATGAACAAATTTAGGTGGG + Intronic
1081265896 11:41020762-41020784 AAAGAAGAACAGAGTGAGATAGG - Intronic
1081889796 11:46531411-46531433 AAAGATTAACAGAATGAGGCTGG + Intronic
1082633869 11:55572846-55572868 CAAGATGACCACAATGATGTGGG - Exonic
1082759320 11:57111624-57111646 CAAGAGGCACAGGTTGAGCTTGG - Intergenic
1085989653 11:81826815-81826837 CAAGACGAAGAGGTAGAGGTGGG + Intergenic
1086378227 11:86223281-86223303 CTAAATGAAAAGAGTGAGGTAGG + Intergenic
1086527851 11:87750045-87750067 AAAGATGTACAGAATGAGTTGGG + Intergenic
1086784427 11:90949191-90949213 CAAAATGAACATTTGGAGGTAGG + Intergenic
1089870215 11:121665817-121665839 TGAGATGAACTGACTGAGGTAGG - Intergenic
1090743486 11:129688197-129688219 CAAGATGAAAAGAATCAAGTTGG + Intergenic
1096587090 12:52629842-52629864 CAAGGGGAACAGATTGAGAAGGG - Intergenic
1097996433 12:65892740-65892762 CAGGATGAATGGATTGAGGACGG - Intronic
1098419132 12:70272905-70272927 AAACAGGAACAGATTCAGGTAGG - Intronic
1099711581 12:86232608-86232630 AAACATGAACAGATTGAGAAGGG + Intronic
1101366064 12:104071697-104071719 GAAGTTAAACAGGTTGAGGTGGG - Intronic
1102485528 12:113252774-113252796 CCACATGAGCAGATTGAGGACGG + Intronic
1103180623 12:118908191-118908213 CAAGATGAACTGATTTTGGCTGG + Intergenic
1103394236 12:120595846-120595868 CAAGAGGTAGAGATTGAGGCTGG - Intergenic
1104063894 12:125290573-125290595 CAAGATGAACACATTGCGGAAGG - Intronic
1104233053 12:126904012-126904034 CAAAATGAAAAGATTGATTTTGG - Intergenic
1106883700 13:34159746-34159768 CAAGATGTACTGATAGAGGCTGG + Intergenic
1106945189 13:34819888-34819910 TAAGATGAATAAATTGAGTTGGG + Intergenic
1107396140 13:40019732-40019754 TAAGAGGAACAGGTTGATGTGGG - Intergenic
1107650506 13:42540374-42540396 ACAGATGCACAGAGTGAGGTAGG + Intergenic
1108408870 13:50128220-50128242 TAAGCTGACCAGATTGGGGTTGG - Intronic
1110277301 13:73654412-73654434 AAACATGAAAAAATTGAGGTTGG + Intergenic
1110440419 13:75520120-75520142 CAAGAGGAAGAGAGAGAGGTGGG - Intergenic
1110974855 13:81818265-81818287 AAACATGAACAGATTTAGGCAGG + Intergenic
1112357197 13:98683569-98683591 ATAGATGAACAGATAAAGGTAGG - Intergenic
1112731039 13:102362555-102362577 CAATATGAACAGAATGATATGGG + Intronic
1114029257 14:18561536-18561558 CAAGATGGACAAATGTAGGTTGG - Intergenic
1114770240 14:25422478-25422500 CAATATGTAAAGAATGAGGTTGG - Intergenic
1115363713 14:32532964-32532986 AAAGTTGAACAAATAGAGGTTGG + Intronic
1115959194 14:38815925-38815947 CAAGGTGAACAGAGTCATGTAGG + Intergenic
1116977352 14:51131083-51131105 CAAAAGGAATGGATTGAGGTGGG - Intergenic
1116997269 14:51336790-51336812 GAAGATGCACAAATTGAAGTTGG + Intergenic
1117221948 14:53615324-53615346 TAAGGTGAACAGATTGAGGCAGG + Intergenic
1117669475 14:58092124-58092146 AAAAATGAACAGATTGAGGTGGG - Intronic
1117901162 14:60534929-60534951 CAAGAAGTACAGAGTGAAGTGGG - Intergenic
1119165026 14:72485492-72485514 CAAGATGAACAGAGTCTGCTTGG - Intronic
1120310733 14:82824441-82824463 CAAGATAAACACTGTGAGGTAGG + Intergenic
1120471512 14:84931607-84931629 CAAGATGAGTGGATTGAGTTAGG + Intergenic
1120894138 14:89514736-89514758 CAAGATGCACAGATGGAGTGAGG - Intronic
1126949495 15:53864990-53865012 ACAGCTGAACAAATTGAGGTTGG - Intergenic
1127196485 15:56591468-56591490 CAGGAGGAAGAGAGTGAGGTGGG + Intergenic
1127305627 15:57703086-57703108 CAAGAAGAACACATTTAGGATGG + Intronic
1127789017 15:62381716-62381738 CAAAATGAACAGGTTGTGGTTGG - Intergenic
1129790061 15:78335176-78335198 CAGGATCAACAGGTTGAGTTTGG - Intergenic
1130993742 15:88892591-88892613 CAAGTTAAACTCATTGAGGTTGG + Intronic
1131946448 15:97627348-97627370 CTGGATGATCAAATTGAGGTTGG + Intergenic
1133635025 16:7657055-7657077 CAGGAAGAACAGATTTAGGTTGG - Intronic
1134896288 16:17889780-17889802 CAAGATGCACAGACAGAGCTTGG - Intergenic
1137435058 16:48448136-48448158 CAAGCTGAACACAGGGAGGTGGG - Intronic
1138843415 16:60537129-60537151 CAAAATGAAGAGATGGAGGAAGG - Intergenic
1139003581 16:62543763-62543785 CCAGATGACCAGAGTGAGGCTGG - Intergenic
1140674781 16:77317143-77317165 GCAGATGTACAGATTGTGGTAGG - Intronic
1140923082 16:79557302-79557324 CAAGATCAGCAGTTTGAGGGTGG + Intergenic
1141402691 16:83764477-83764499 CAGGATGAACTGGTTGAGATGGG - Intronic
1143769936 17:9162135-9162157 GAAGCTGGACAGGTTGAGGTGGG + Intronic
1144647330 17:16984274-16984296 TAAGAAGAGCAGATTGGGGTGGG + Intergenic
1147484667 17:40801153-40801175 GATGATGATCAGATTGATGTGGG + Intergenic
1148250046 17:46069446-46069468 CAAAAAGAACAGACTGAGGCTGG + Intronic
1151298496 17:73203776-73203798 GAAGAAAAACAGATTAAGGTAGG + Exonic
1153366870 18:4266191-4266213 CAAGAAGAAGTGATGGAGGTTGG - Intronic
1155881493 18:31154769-31154791 AAATATGAACAGTTTGCGGTAGG - Exonic
1156598822 18:38579708-38579730 CCAGAAGAACAGAAGGAGGTGGG + Intergenic
1156599965 18:38594365-38594387 CAACATGACCAGTGTGAGGTAGG - Intergenic
1156688290 18:39675970-39675992 CAGGATGAAGAGAATGAGTTGGG + Intergenic
1156942165 18:42781379-42781401 TAAGAAGAACAGATTGAAATTGG + Intronic
1161302024 19:3547436-3547458 CAAGGTGAGCAGATTGGGGCGGG - Exonic
1161967493 19:7556552-7556574 CAGGATAAGCAGATTGAGGTAGG + Exonic
1162315762 19:9936980-9937002 TAAGAGGAAAAAATTGAGGTTGG + Intergenic
1164867438 19:31616451-31616473 CAAGATGAAAATATGGAGTTCGG + Intergenic
929120648 2:38481372-38481394 CAAGAAAAACAGATAGAGGAAGG + Intergenic
929386257 2:41410984-41411006 CAAGCAGACCAGATTGACGTGGG + Intergenic
930082176 2:47459880-47459902 CAAGATGAAAAGAATGAGGAAGG - Intronic
931096304 2:58944356-58944378 CAAGAGGAAGAGAGAGAGGTGGG + Intergenic
933212586 2:79587789-79587811 AAAGATGAATAGTTTGAGCTGGG - Intronic
935815921 2:106845629-106845651 CAAGGTGACCACATTGAGGTAGG - Intronic
936780751 2:116029795-116029817 CCAGATGAACAGATAAAAGTTGG - Intergenic
938928635 2:136066747-136066769 CAAGATTCACAGATGGAGGATGG + Intergenic
939395124 2:141619145-141619167 CAAGAAAAGCAGGTTGAGGTGGG - Intronic
940255639 2:151725448-151725470 CAAGATCAACTCAGTGAGGTGGG - Exonic
942849372 2:180465711-180465733 CAAGAAGAAGAGGTTGTGGTAGG + Intergenic
943850261 2:192711522-192711544 CTAGATAAACAGGTTGAGGGTGG + Intergenic
944869343 2:203894129-203894151 CAAGAAGACCAGACTGAGATAGG + Intergenic
945523872 2:210864332-210864354 TAAGTTGAACATATTGAGATGGG + Intergenic
947364472 2:229380100-229380122 CAAGTTGATCAAATTGACGTTGG + Intronic
947941201 2:234057152-234057174 CAAGGTAAACAGATTGGGGCAGG - Intronic
1170015046 20:11770988-11771010 AAAGAAGAACAGATTGACGAGGG - Intergenic
1172957379 20:38770804-38770826 CAACATGCACAAATGGAGGTGGG - Intronic
1174124827 20:48296751-48296773 CAAGATGCACAGACTCACGTGGG - Intergenic
1174379631 20:50148348-50148370 ACAGATGAGCAGACTGAGGTGGG + Intronic
1174804972 20:53597171-53597193 TTAGAAGAACAGAATGAGGTAGG + Intronic
1175038804 20:56026257-56026279 CAAGACCATAAGATTGAGGTGGG - Intergenic
1179280977 21:39934023-39934045 CAAGATGATGATATTGAAGTGGG - Intergenic
1180453373 22:15488599-15488621 CAAGATGGACAAATGTAGGTTGG - Intergenic
1183397392 22:37579854-37579876 AAAGATGAACAGAGTGGGGCAGG + Intronic
1184029420 22:41883086-41883108 AGAGATGAACAGATAGAGGATGG + Intronic
949388546 3:3533343-3533365 AAAGATGAACAGTTTGAGCACGG - Intergenic
950748750 3:15111972-15111994 CAAGATGAACAGGTTTATTTGGG + Intergenic
951532256 3:23709120-23709142 CAAGAATAACATATTGAGGGTGG + Intergenic
953957155 3:47240402-47240424 CCAGGTGGTCAGATTGAGGTGGG - Intronic
954870060 3:53761075-53761097 GAAGTTGAACAGATGGAGTTGGG + Intronic
957735604 3:84197670-84197692 CAAAGTTAACAGATTCAGGTAGG - Intergenic
959659450 3:108849845-108849867 GAGGTTGAACAGATTGTGGTAGG - Intronic
961064596 3:123864464-123864486 CAAGATGGACTGATTGACGATGG + Intronic
961738286 3:129015783-129015805 CAGGAAGAACAGCTTGGGGTAGG - Intronic
961942006 3:130647547-130647569 CGAGATGAACAGTTTGATTTGGG + Intronic
963025265 3:140913093-140913115 CAAGAGGAGCAGTTTGAGGGAGG - Intergenic
963528971 3:146449336-146449358 CTTGATGAACAAATTGTGGTTGG - Exonic
965240544 3:166191426-166191448 CAAGATGAGCCATTTGAGGTTGG + Intergenic
965894492 3:173558579-173558601 CTAGATGAACTGAATGGGGTAGG - Intronic
967761327 3:193229061-193229083 CAACTTCAATAGATTGAGGTGGG - Intergenic
970279314 4:14436581-14436603 CATGATGAACTGATCAAGGTGGG + Intergenic
970914063 4:21311784-21311806 CAAGATGAACAGATGCAGTGAGG + Intronic
971147689 4:23996584-23996606 CAAGAGAAACAGAGTGGGGTTGG - Intergenic
972226833 4:37023206-37023228 AAAGTTGAACAAATTGAGGTGGG + Intergenic
975438683 4:74384596-74384618 AAAGTTGAACAGATTTAGGTTGG - Intronic
977803630 4:101269749-101269771 CATGATGTTCACATTGAGGTGGG - Intronic
978012590 4:103705979-103706001 CAATATGAACACATTAGGGTAGG + Intronic
978860383 4:113442093-113442115 CAAGTTGAAGAGATAGAGGTGGG - Intergenic
979734801 4:124070164-124070186 CAGGAAGAAGAGATAGAGGTAGG + Intergenic
980627392 4:135391083-135391105 CAAGAGGAAGAGAGTGAGGGGGG + Intergenic
980748626 4:137057942-137057964 AACGAAGAACAGATTGAGTTAGG - Intergenic
981047510 4:140278868-140278890 CAAGAAGAACAGATGGGGTTGGG - Intronic
981232679 4:142376251-142376273 CAAGATGAAAATAGTCAGGTGGG - Intronic
987386570 5:17335452-17335474 CAGGGAGAACAGATTTAGGTTGG + Intergenic
987502052 5:18724660-18724682 CAAGATGAAAAGAGTTAGGAAGG - Intergenic
988191592 5:27943956-27943978 GAAGAAGCACAGTTTGAGGTGGG - Intergenic
988294527 5:29338059-29338081 GAAGAAGTACAGATTTAGGTGGG - Intergenic
993323908 5:86510606-86510628 AAAGATGAAATGATGGAGGTCGG + Intergenic
993527308 5:88981639-88981661 CAAGAGGGACAGAGTGAGCTAGG - Intergenic
994903475 5:105805262-105805284 GAAGATAAATAGATTGAGGAAGG - Intergenic
996663976 5:126036180-126036202 CAAGATGAGAAGATTTGGGTGGG + Intergenic
997035543 5:130186834-130186856 AAAGCTGAAGAGATTGAGGAAGG - Intergenic
1004999035 6:21222446-21222468 CAGGATCAACAAATTGAAGTTGG - Intronic
1007997422 6:46322937-46322959 GAAAATGAACAAATTAAGGTGGG - Intronic
1009297812 6:61976036-61976058 CAAGATGAAATCATAGAGGTAGG + Intronic
1010781988 6:79954262-79954284 AAAGAAGAACAGATTGTGGGAGG - Intergenic
1011938309 6:92810707-92810729 CAAGGTCAACAGATGTAGGTGGG + Intergenic
1014241257 6:119020455-119020477 CAAGCTAAACAGGTTGAAGTAGG + Intronic
1014989244 6:128053445-128053467 CAAGATGAAGAGCTTGGGGGTGG - Intronic
1015908158 6:138138735-138138757 CAAGATGAAAAGAATTAGGCAGG + Intergenic
1017958010 6:159195340-159195362 CAAGGTGAAGTGATTGTGGTGGG + Intronic
1018188554 6:161288772-161288794 CAAGATGGAAAGATTCAGGTGGG - Intergenic
1018705026 6:166457750-166457772 CCAGATGAACACATTGAGGAGGG - Intronic
1019327590 7:445941-445963 GAAGAGGAAAAGATGGAGGTGGG + Intergenic
1021108036 7:16661494-16661516 GAAGATTAACAGACTGAGGTAGG + Intronic
1021321209 7:19214491-19214513 CAAGTTTTACACATTGAGGTAGG + Intergenic
1021650381 7:22827273-22827295 GAAGATAAACAGATTTAGGGAGG - Intergenic
1026658073 7:72274850-72274872 CAAAATGATCAGATTAAAGTTGG - Intronic
1028363628 7:89999601-89999623 TAAGAGGAAGAGATTGAGCTAGG - Intergenic
1028964249 7:96784067-96784089 AAAGATGAACAGTTTGGTGTGGG - Intergenic
1030282456 7:107791001-107791023 CAAGATGAACAGATTGAGGTGGG + Intronic
1031971569 7:128068536-128068558 GAAGAGGAACAGTTTGGGGTGGG + Intronic
1032510257 7:132466607-132466629 CAAGATGCAAGGATGGAGGTGGG + Intronic
1033720622 7:144055783-144055805 AAAACTGAAGAGATTGAGGTGGG + Intergenic
1034485880 7:151362069-151362091 CAGGATAAAAAGATTGAGGGAGG - Intronic
1034720588 7:153289198-153289220 CAAGATGAGCAAATAGAAGTTGG + Intergenic
1037088829 8:14887059-14887081 CAAGAGGAACAGGTTGAAGGAGG + Intronic
1037611943 8:20483274-20483296 CAAGGTCTAGAGATTGAGGTAGG + Intergenic
1037760950 8:21741214-21741236 AGAGATGCACAGGTTGAGGTTGG - Intronic
1038517258 8:28197558-28197580 CTAGTTGAACAGACTGAGCTGGG - Intergenic
1038885619 8:31659533-31659555 CAGGAGCAACAGATTGGGGTAGG + Intronic
1039079420 8:33721103-33721125 TAAGAAGAAGAGATTGAGCTGGG - Intergenic
1041843477 8:62298722-62298744 CTGGAGGAACAGATTTAGGTTGG - Intronic
1042428120 8:68672821-68672843 CAAGCTGCACTGCTTGAGGTTGG - Intronic
1043332046 8:79129637-79129659 CAAGATGATGGGATAGAGGTTGG + Intergenic
1044210468 8:89544101-89544123 TAAGATGAACAATTTGAGGAAGG + Intergenic
1044543025 8:93429087-93429109 CATGATGAAAACATTGGGGTAGG - Intergenic
1045970782 8:108077503-108077525 CAAGATGAAAAGATGGGAGTGGG - Intronic
1052178512 9:25495662-25495684 CAAGAAAAAGAGATTGAAGTTGG - Intergenic
1052664564 9:31478215-31478237 CAAGAGGAAGAGAGTGAAGTGGG + Intergenic
1054812293 9:69444506-69444528 GAAGATGAGGAAATTGAGGTGGG - Intronic
1054841121 9:69741305-69741327 GAAGAGAAACAGATTTAGGTAGG - Intronic
1056066379 9:82939739-82939761 CAAGAGGAAAAGGTTGAGTTAGG + Intergenic
1056314798 9:85377499-85377521 GAAGATGAAGAGAGTGATGTAGG - Intergenic
1056880107 9:90383405-90383427 CAAGATCAACAGCTTGAGTGTGG + Intergenic
1060367711 9:123035132-123035154 CACGATGAACAGGGTGAAGTAGG - Exonic
1062293745 9:135812285-135812307 CGAGATGAACAGCATGGGGTCGG + Intronic
1185704605 X:2257441-2257463 CTAGATGACCAGATGGTGGTAGG - Intronic
1188876793 X:35440623-35440645 CAAGATGTGCTGATTGTGGTTGG + Intergenic
1189056671 X:37706533-37706555 GCAGATAAAGAGATTGAGGTTGG + Intronic
1189948149 X:46201784-46201806 CAAGATCAACAGAAGGAAGTTGG - Intergenic
1190917641 X:54822104-54822126 CACGATGAAGATCTTGAGGTGGG + Intergenic
1191093058 X:56644488-56644510 CAAGATGAACAGAAGGAAATTGG - Intergenic
1193442450 X:81559599-81559621 CAAAATGAATAGATTGATATAGG + Intergenic
1195638315 X:107143911-107143933 CAAGATGAAGAAATTGAGAGTGG - Intronic
1196213354 X:113021439-113021461 CAAGATGGAAAGCTAGAGGTGGG - Intergenic
1196270462 X:113704552-113704574 CAGGGTGAACAGTTTGGGGTTGG + Intergenic
1198131238 X:133697432-133697454 CAAGCTCAGCAGATTGAGGAAGG - Intronic
1198664067 X:139002576-139002598 CAAGCTGTACAGCTTGGGGTTGG - Intronic
1199020431 X:142871361-142871383 CAAGATGATGAGATTTGGGTGGG - Intergenic
1200411257 Y:2864160-2864182 TAAGATGCTCAGATTGAGTTGGG + Intronic