ID: 1030286381

View in Genome Browser
Species Human (GRCh38)
Location 7:107831252-107831274
Sequence ATTGGCATTTATGGCCCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030286381_1030286388 0 Left 1030286381 7:107831252-107831274 CCAGGTGGGCCATAAATGCCAAT No data
Right 1030286388 7:107831275-107831297 CCTTATAAGAAGGAGGTGGAAGG No data
1030286381_1030286386 -4 Left 1030286381 7:107831252-107831274 CCAGGTGGGCCATAAATGCCAAT No data
Right 1030286386 7:107831271-107831293 CAATCCTTATAAGAAGGAGGTGG No data
1030286381_1030286384 -7 Left 1030286381 7:107831252-107831274 CCAGGTGGGCCATAAATGCCAAT No data
Right 1030286384 7:107831268-107831290 TGCCAATCCTTATAAGAAGGAGG No data
1030286381_1030286383 -10 Left 1030286381 7:107831252-107831274 CCAGGTGGGCCATAAATGCCAAT No data
Right 1030286383 7:107831265-107831287 AAATGCCAATCCTTATAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030286381 Original CRISPR ATTGGCATTTATGGCCCACC TGG (reversed) Intergenic
No off target data available for this crispr