ID: 1030286382

View in Genome Browser
Species Human (GRCh38)
Location 7:107831261-107831283
Sequence CTTATAAGGATTGGCATTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030286382_1030286388 -9 Left 1030286382 7:107831261-107831283 CCATAAATGCCAATCCTTATAAG No data
Right 1030286388 7:107831275-107831297 CCTTATAAGAAGGAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030286382 Original CRISPR CTTATAAGGATTGGCATTTA TGG (reversed) Intergenic
No off target data available for this crispr