ID: 1030286386

View in Genome Browser
Species Human (GRCh38)
Location 7:107831271-107831293
Sequence CAATCCTTATAAGAAGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030286381_1030286386 -4 Left 1030286381 7:107831252-107831274 CCAGGTGGGCCATAAATGCCAAT No data
Right 1030286386 7:107831271-107831293 CAATCCTTATAAGAAGGAGGTGG No data
1030286379_1030286386 6 Left 1030286379 7:107831242-107831264 CCCTGATTATCCAGGTGGGCCAT No data
Right 1030286386 7:107831271-107831293 CAATCCTTATAAGAAGGAGGTGG No data
1030286380_1030286386 5 Left 1030286380 7:107831243-107831265 CCTGATTATCCAGGTGGGCCATA No data
Right 1030286386 7:107831271-107831293 CAATCCTTATAAGAAGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030286386 Original CRISPR CAATCCTTATAAGAAGGAGG TGG Intergenic
No off target data available for this crispr