ID: 1030286388

View in Genome Browser
Species Human (GRCh38)
Location 7:107831275-107831297
Sequence CCTTATAAGAAGGAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030286380_1030286388 9 Left 1030286380 7:107831243-107831265 CCTGATTATCCAGGTGGGCCATA No data
Right 1030286388 7:107831275-107831297 CCTTATAAGAAGGAGGTGGAAGG No data
1030286381_1030286388 0 Left 1030286381 7:107831252-107831274 CCAGGTGGGCCATAAATGCCAAT No data
Right 1030286388 7:107831275-107831297 CCTTATAAGAAGGAGGTGGAAGG No data
1030286382_1030286388 -9 Left 1030286382 7:107831261-107831283 CCATAAATGCCAATCCTTATAAG No data
Right 1030286388 7:107831275-107831297 CCTTATAAGAAGGAGGTGGAAGG No data
1030286379_1030286388 10 Left 1030286379 7:107831242-107831264 CCCTGATTATCCAGGTGGGCCAT No data
Right 1030286388 7:107831275-107831297 CCTTATAAGAAGGAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030286388 Original CRISPR CCTTATAAGAAGGAGGTGGA AGG Intergenic
No off target data available for this crispr