ID: 1030289079

View in Genome Browser
Species Human (GRCh38)
Location 7:107854600-107854622
Sequence GTGAAAATATAGATGTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030289077_1030289079 9 Left 1030289077 7:107854568-107854590 CCTCTGTGTCTTAGTGCAGTGTA No data
Right 1030289079 7:107854600-107854622 GTGAAAATATAGATGTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030289079 Original CRISPR GTGAAAATATAGATGTAGCT GGG Intergenic
No off target data available for this crispr