ID: 1030289223

View in Genome Browser
Species Human (GRCh38)
Location 7:107855729-107855751
Sequence CTTTGGAAGGCCAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030289216_1030289223 -7 Left 1030289216 7:107855713-107855735 CCTGTAATCCCAGCACCTTTGGA 0: 38
1: 5819
2: 305602
3: 330209
4: 365222
Right 1030289223 7:107855729-107855751 CTTTGGAAGGCCAAGGTGGAAGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030289223 Original CRISPR CTTTGGAAGGCCAAGGTGGA AGG Intergenic
Too many off-targets to display for this crispr