ID: 1030303108

View in Genome Browser
Species Human (GRCh38)
Location 7:107993715-107993737
Sequence GTGATTAAACTGATGCTCAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 198}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030303108_1030303111 -1 Left 1030303108 7:107993715-107993737 CCGATGAGCATCAGTTTAATCAC 0: 1
1: 0
2: 1
3: 18
4: 198
Right 1030303111 7:107993737-107993759 CCAGATTGTGTGGTCAATGAAGG 0: 1
1: 0
2: 0
3: 21
4: 193
1030303108_1030303113 8 Left 1030303108 7:107993715-107993737 CCGATGAGCATCAGTTTAATCAC 0: 1
1: 0
2: 1
3: 18
4: 198
Right 1030303113 7:107993746-107993768 GTGGTCAATGAAGGGACAAGCGG No data
1030303108_1030303114 12 Left 1030303108 7:107993715-107993737 CCGATGAGCATCAGTTTAATCAC 0: 1
1: 0
2: 1
3: 18
4: 198
Right 1030303114 7:107993750-107993772 TCAATGAAGGGACAAGCGGTTGG No data
1030303108_1030303115 20 Left 1030303108 7:107993715-107993737 CCGATGAGCATCAGTTTAATCAC 0: 1
1: 0
2: 1
3: 18
4: 198
Right 1030303115 7:107993758-107993780 GGGACAAGCGGTTGGTGACAAGG No data
1030303108_1030303112 0 Left 1030303108 7:107993715-107993737 CCGATGAGCATCAGTTTAATCAC 0: 1
1: 0
2: 1
3: 18
4: 198
Right 1030303112 7:107993738-107993760 CAGATTGTGTGGTCAATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030303108 Original CRISPR GTGATTAAACTGATGCTCAT CGG (reversed) Intronic
901766768 1:11505022-11505044 GTGATAAAACTGTAGCTCAGAGG - Intronic
902998851 1:20249912-20249934 GTGATTAAATTGAGGATCTTGGG + Intergenic
904046333 1:27611266-27611288 GTGAGAAAACTGAGGCTCAGGGG - Intergenic
904828880 1:33294276-33294298 ATGAGGAAACTGATGCTCAGTGG + Intronic
905348831 1:37330472-37330494 GTGAGGAAACTGAAGCTCAGAGG + Intergenic
905453898 1:38074479-38074501 ATGAGGAAACTGAGGCTCATTGG + Intergenic
906738817 1:48160606-48160628 GTTATTCAACTGTTTCTCATGGG - Intergenic
907661149 1:56393516-56393538 GTGAGGAAAGTGATGCTCAGAGG - Intergenic
910011709 1:82471823-82471845 TTGATTAAATTGTTGGTCATTGG + Intergenic
910984671 1:92993837-92993859 GTGATCAAAGTTATGCTCAGTGG - Intergenic
911715937 1:101133141-101133163 GTGGTTAAAATGATGGTCTTGGG + Intergenic
913452703 1:119002829-119002851 GTGAGAAAACTGAGGCTCAAAGG + Intergenic
915184047 1:154089118-154089140 GTGATTAAACTGATTAGAATTGG - Intronic
915901706 1:159851442-159851464 ATGAATAAACTGAGGCTCAGAGG - Intronic
916188474 1:162156296-162156318 TAGATTAAACTGAGGCTCAGAGG + Intronic
917025694 1:170639040-170639062 GAGAGTAAAATGATGCTTATTGG - Intergenic
918616996 1:186556233-186556255 GAGATAAAACTGTTACTCATTGG - Intergenic
919564301 1:199164654-199164676 ATGATAAAACTGAAGCTCAAAGG - Intergenic
920910760 1:210214210-210214232 TTGATTAATTTGATGCTAATCGG - Intergenic
923594541 1:235350499-235350521 CTCATTAAATTGATACTCATAGG - Intergenic
923919877 1:238551910-238551932 GTGATGAAATGGATACTCATTGG + Intergenic
924155580 1:241173117-241173139 GTGCATAAACTGAGGCCCATAGG + Intronic
1064288187 10:14011012-14011034 GTGAAGAAACTGGTGCTCAGAGG + Intronic
1067308893 10:45093739-45093761 GTGATGAAACCGATGCTCTGAGG - Intergenic
1067346241 10:45441005-45441027 GTGAGGAAACTGAGGCACATGGG - Intronic
1067394333 10:45899697-45899719 GTGATAAAACTGAAGCTTAGAGG + Intergenic
1067494759 10:46751810-46751832 GCGATGAAACTGAGGCTCAGGGG + Intergenic
1067599896 10:47588587-47588609 GCGATGAAACTGAGGCTCAGGGG - Intergenic
1067862657 10:49868828-49868850 GTGATAAAACTGAAGCTTAGAGG + Intronic
1067980890 10:51083154-51083176 GAGATTAAAGTGATGCTGATAGG - Intronic
1069882476 10:71602389-71602411 GTGAGGAAACTGAGGCTCAAAGG + Intronic
1071651431 10:87396470-87396492 GTGATGAAACTGAGGCTCAGGGG - Intergenic
1071793870 10:88985183-88985205 GTGAGAAAACTGATGCTGAGAGG + Intronic
1072873420 10:99145549-99145571 ATAATTCAACTGATTCTCATAGG + Intronic
1073749705 10:106510791-106510813 GTGATCAAAGTCATGCTAATAGG + Intergenic
1075256524 10:120929967-120929989 GTGAGTAAACTGAGGCACAGAGG - Intergenic
1080746715 11:35114970-35114992 ATGAGTAAACTGAGGCTCAGGGG + Intergenic
1081292447 11:41343316-41343338 GTGATTCAACTGATTCTTATTGG + Intronic
1081529532 11:43948388-43948410 GTGAGAAAACTGAAGCTCAGAGG + Intergenic
1083628303 11:64083071-64083093 GTGAGGAAACTGAGGCTCAGGGG + Intronic
1084277688 11:68063117-68063139 ATGATTAAACTTATGTTTATCGG - Intronic
1084561168 11:69906221-69906243 GTGAGGAAACTGAGGCTCAGAGG - Intergenic
1085198183 11:74684614-74684636 GTGAGGAAACTGAGGCCCATTGG - Intergenic
1085447540 11:76610761-76610783 GTGGTTACCCTGATGCACATTGG + Intergenic
1086254134 11:84854327-84854349 ATGAGGAAACTGATGCTCAGAGG - Intronic
1086508063 11:87526972-87526994 GTGATTAAATTGTTGGTCATTGG - Intergenic
1086850784 11:91805102-91805124 GTGATTAGAATGATGGTAATCGG - Intergenic
1088576522 11:111277613-111277635 GTGCTGATGCTGATGCTCATCGG + Intronic
1089112398 11:116067183-116067205 GTGACAAAACTGAGGCTCAGAGG - Intergenic
1089325857 11:117656350-117656372 CTGATGAAACTGAGGCTCAGAGG - Intronic
1089655126 11:119941664-119941686 GTAATTAAACTGAGGATCAGAGG + Intergenic
1089959402 11:122602481-122602503 ATGATAAAACTGATGCCCAGGGG + Intergenic
1090437322 11:126697513-126697535 GTGACACAACTGATGCTCAGTGG + Intronic
1090924386 11:131236663-131236685 ATGAGAAAACTGAGGCTCATGGG + Intergenic
1091028864 11:132165619-132165641 GTGAGGAAACTGAGGCTCAGGGG + Intronic
1093315974 12:17649999-17650021 TTAATTAAACTATTGCTCATTGG - Intergenic
1094249779 12:28346801-28346823 ATGATTAAACTGTTGGCCATTGG + Intronic
1095615459 12:44182988-44183010 ATGATTATAATGATGTTCATTGG - Intronic
1098797185 12:74904668-74904690 GTGAGTTAACTGATGGCCATAGG - Intergenic
1101095644 12:101337096-101337118 GTGATGAAACTGAGGCTCAGAGG - Intronic
1101272728 12:103164836-103164858 GTGAGTATACTGATACACATGGG - Intronic
1101966865 12:109287755-109287777 GTGAGTAAACTGAGGCTCAGAGG + Intronic
1102247341 12:111363564-111363586 ATGAGGAAACTGACGCTCATAGG + Intronic
1102649732 12:114431099-114431121 GTGGGTAAACTGAGGCTCAAAGG + Intergenic
1104620518 12:130308370-130308392 GTGATAAAGATGATCCTCATTGG + Intergenic
1106860642 13:33903816-33903838 GTGATAACTCTGATGCTAATTGG + Intronic
1107616745 13:42176696-42176718 CTGAATAAACTGAGGCTGATTGG + Intronic
1108139859 13:47408947-47408969 GACATTAAACTGCTGATCATTGG - Intergenic
1111166824 13:84468992-84469014 TTGATAAAACTCATGCTAATAGG - Intergenic
1111900971 13:94199454-94199476 ATGAGGAAACTGAAGCTCATAGG - Intronic
1117885213 14:60354238-60354260 GTTGCTAAACTGATGCTGATGGG - Intergenic
1119873179 14:78034237-78034259 GTGCCTAAACTGAAGCTCAATGG - Intergenic
1122004466 14:98690648-98690670 ATGAGTAAACTGAGGCTCAAAGG + Intergenic
1125245684 15:37635747-37635769 ATGATTATAGTGATGCTGATGGG + Intergenic
1126924475 15:53567699-53567721 GTGTTTAAACTGATCTTTATAGG + Intronic
1127302204 15:57665951-57665973 ATGCTGAAACTGATGCTCAGAGG - Intronic
1127378189 15:58404291-58404313 ATGAGTAAACTGATGCTCACTGG + Intronic
1127406204 15:58649681-58649703 GTGATTAAACTTTTTCTCACCGG + Intronic
1129939453 15:79481077-79481099 CTGAAGAAACTGATGCTCGTGGG + Intergenic
1134684122 16:16146868-16146890 GTGAGGAAACTGAGGCTCAAGGG - Intergenic
1135044009 16:19139907-19139929 GTGAATAAACTGAGGTTCAGAGG - Intronic
1135718416 16:24793175-24793197 GGAATTAAACTGATGCTCAAAGG + Intronic
1136037467 16:27550749-27550771 ATGATGAAACTGAGGCTCAGAGG + Intronic
1137568141 16:49546944-49546966 GTGAGAAAACTGAGGCTCAGAGG - Intronic
1138477590 16:57281278-57281300 GTGAGAAAACTGAGGCTCAGAGG - Intronic
1140861562 16:79022898-79022920 CTGAGTAAACTGATGCTCAGGGG - Intronic
1142798755 17:2330413-2330435 GTGACTAAAATTTTGCTCATTGG - Intronic
1143256285 17:5560386-5560408 ATGAGAAAACTGAGGCTCATAGG - Intronic
1144954762 17:19013496-19013518 GTCATGGAACTGATGCCCATCGG + Exonic
1147467335 17:40620289-40620311 GTCAGGAAACTGATGCTTATTGG + Intergenic
1148799003 17:50211263-50211285 TTGAGGAAACTGAGGCTCATTGG - Intergenic
1149165993 17:53752734-53752756 GTCATTAAACTTATGTTCATGGG + Intergenic
1153223664 18:2882120-2882142 GTGAGAAAACAGAGGCTCATGGG - Intronic
1158577439 18:58650834-58650856 TTGATTAATATCATGCTCATTGG + Intergenic
1158915724 18:62126856-62126878 TTTACTAAACTGCTGCTCATAGG - Intronic
1159851430 18:73530839-73530861 TTGAATAAACTAATGATCATGGG - Intergenic
1159905243 18:74083969-74083991 GTGATAAAACTGATGCAGAGAGG + Intronic
1160193314 18:76733012-76733034 GTAATTAAACCCATGCACATTGG + Intergenic
1161380692 19:3963652-3963674 GTGATGACACCGATGCTCCTGGG + Exonic
1162768439 19:12934328-12934350 GTGAGAAAACTGAGGCTCAGAGG + Intergenic
1163328455 19:16620332-16620354 GTGAGGAAACTGAGGCTCAGCGG - Intronic
1164218439 19:23172120-23172142 GTCATTAGACTGATGCCCTTTGG - Intergenic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
1167242930 19:48355867-48355889 GAGGTCAAACTGATGCTCAGTGG - Intronic
926043207 2:9691262-9691284 GTGATGAGACTGAGGCTCAGAGG - Intergenic
927381268 2:22481811-22481833 GTGAGGAAACTGAGGCTCAAGGG + Intergenic
935082493 2:99811968-99811990 GAGACTAAAATAATGCTCATTGG - Intronic
937086789 2:119177229-119177251 GTGAGAAAACTGAGGCTCACAGG - Intergenic
939348970 2:141007191-141007213 GTTATTATACTGAGGCTCAGAGG + Intronic
941849782 2:170168184-170168206 GTGACAAAACTGAGGCTCAGGGG + Intergenic
942308658 2:174633626-174633648 GTAATTAAACTGTCCCTCATTGG + Intronic
943107403 2:183562633-183562655 TTAATTTAAATGATGCTCATAGG + Intergenic
943770936 2:191716024-191716046 GTTCTTAAGTTGATGCTCATTGG + Intergenic
946674273 2:222141713-222141735 GTGATGAAAATGAGTCTCATGGG - Intergenic
1170029210 20:11927292-11927314 GTGATTAAACTGATGAGAGTGGG - Intergenic
1171253642 20:23669366-23669388 GTGATAACAGTGATGCTGATGGG - Intergenic
1173865461 20:46309625-46309647 GTGATTAAATGGCTGGTCATTGG - Intergenic
1174162036 20:48558063-48558085 GTGATGAAACTGAGGCACACAGG - Intergenic
1174987517 20:55471779-55471801 GGCATTATACTCATGCTCATTGG - Intergenic
1175606164 20:60314111-60314133 GGGATTACAGTGATTCTCATAGG + Intergenic
1176672358 21:9746398-9746420 GTGTTTAATCTTATTCTCATTGG - Intergenic
1177909863 21:27017717-27017739 GGGATTAAAATGATGCTGAGTGG - Intergenic
1179316581 21:40249127-40249149 ATGACAAAACTGATGTTCATTGG - Intronic
1179333947 21:40432503-40432525 GTGATTAAATTGAGGATCTTTGG - Intronic
1184243683 22:43224798-43224820 CTGATGAAAGTGATGATCATGGG + Intronic
949096675 3:94727-94749 GTGATAAAACTAAAGCTCAGAGG - Intergenic
949909458 3:8889312-8889334 GTGAGGAAACTGAGGCTCAAAGG - Intronic
950778662 3:15372634-15372656 GTGAGTAAGCTCATGCTCATGGG - Intergenic
952742156 3:36744544-36744566 GTGGTGAAACTGAGGTTCATAGG - Intergenic
952919121 3:38272782-38272804 GTTATTTAACTGATGGTGATTGG + Intronic
954751464 3:52816578-52816600 GTGAAGAAACTGAGGCTCAGAGG + Intronic
955619399 3:60846492-60846514 GTGATTAAAGTGATCTTCAATGG - Intronic
957548698 3:81675381-81675403 GTGTTTAATCTGATTCTCACTGG - Intronic
959430336 3:106246559-106246581 TTGATAAAACTAATGCTCAAAGG + Intergenic
959940979 3:112080853-112080875 AAGATGAAACTGATGATCATGGG + Intronic
959973661 3:112434459-112434481 TTGAGTAAACTGAGGCTCAGAGG - Intergenic
961533610 3:127555722-127555744 GTGATAAAGCTGAGGCTCAGAGG - Intergenic
962210640 3:133474573-133474595 GTGTTTATACAGATGCTCATAGG - Intronic
963535135 3:146518398-146518420 GTGTTTATACTCATGCTTATGGG - Intronic
964671742 3:159233646-159233668 ATGATAAAACTGAGGCTCAAAGG + Intronic
967529305 3:190530904-190530926 GTGAAAAAACTGAAGCTCAGAGG + Intronic
969254827 4:5994588-5994610 GTGAGGAAACTGAGGCTCAGAGG + Intergenic
970383104 4:15528059-15528081 GTGTTTCAACTGATGCTCAAAGG + Intronic
971017150 4:22500028-22500050 GGGATTGACATGATGCTCATAGG - Intronic
978293536 4:107175555-107175577 GTCATGAAAATGATGCTCTTTGG + Intronic
980832781 4:138151973-138151995 GTGATTAAATTGAAGCTCTTGGG + Intergenic
981895316 4:149791996-149792018 GAGACTAAACTGATGCAAATAGG + Intergenic
985322821 4:188733844-188733866 GTGATTCACTTGATGGTCATAGG - Intergenic
985402372 4:189605444-189605466 GTGTTTAATCTTATTCTCATTGG + Intergenic
985872063 5:2564841-2564863 CTGATTAAGCTGATTCTCACGGG + Intergenic
988185494 5:27855565-27855587 GTGATTAAATTGAGGATCTTGGG - Intergenic
988259701 5:28869621-28869643 TTGATTGTACTGATGCTCAAGGG + Intergenic
990760973 5:59128897-59128919 GTGAGGAAACTGATGCCCAAAGG + Intronic
993643696 5:90436632-90436654 GTGATTAAACTGATGATACATGG - Intergenic
996357989 5:122617722-122617744 GTAATTACACTGAACCTCATTGG - Intergenic
997721755 5:136083486-136083508 ATGAGTAAACTGAGGCTCAAAGG + Intergenic
998134523 5:139667743-139667765 ATGAAGAAACTGAAGCTCATAGG - Intronic
998787743 5:145730711-145730733 GTCATTAGACTGATGCCCTTTGG - Intronic
998827127 5:146114091-146114113 TTCATTAAACTCATGCACATTGG - Exonic
999648623 5:153743877-153743899 GTGGATAATCTCATGCTCATTGG + Intronic
1000955576 5:167538955-167538977 GTGATTATAATAATGCTGATCGG - Intronic
1002543854 5:179925276-179925298 CTGATTAAACTGTTGGCCATGGG - Intronic
1003877479 6:10451309-10451331 TTGATTAAACTCTTGGTCATTGG - Intergenic
1006264223 6:32904163-32904185 GAGTTTAAACTGAGGCTAATTGG + Intergenic
1006501220 6:34460187-34460209 CTGAGGAAACTGAGGCTCATTGG - Intergenic
1006615958 6:35327079-35327101 GTGAGGAAACTGAGGCTCAGAGG - Intergenic
1008886510 6:56436827-56436849 GTGAGAAAACTGAGGCTCACAGG + Intergenic
1009700864 6:67178241-67178263 GTGAATAAATTGATACTGATTGG - Intergenic
1009897519 6:69771460-69771482 GTGGCTAAAATGATGCTGATGGG - Intronic
1012888333 6:104870995-104871017 CTGATTTAGCTGAGGCTCATGGG + Intergenic
1013985730 6:116190993-116191015 GTGAGGAAACTGAGGCTCAGAGG + Intronic
1015080277 6:129216363-129216385 ATAATTAAACTGATGTTCTTTGG + Intronic
1016662512 6:146598242-146598264 GTGAGTAAACTGAGACTCAAAGG + Intergenic
1019830792 7:3327443-3327465 GTGATTAAAATGATGCTTTTGGG + Intronic
1021078979 7:16340478-16340500 GACATAAAAATGATGCTCATAGG + Intronic
1023369181 7:39496110-39496132 ATGAAGAAACTAATGCTCATGGG + Intergenic
1030303108 7:107993715-107993737 GTGATTAAACTGATGCTCATCGG - Intronic
1030918174 7:115343785-115343807 ATGAGAAAACTGATGCTCATGGG + Intergenic
1031518743 7:122736421-122736443 GTGTGAAAACTGGTGCTCATAGG + Intronic
1031945138 7:127831674-127831696 GTGATGAAACAGATGCTCAAAGG + Intronic
1032912209 7:136446220-136446242 GTGATTACATTAATGTTCATTGG + Intergenic
1035156238 7:156915632-156915654 GTGAGAAAACTGAGGCTCCTGGG + Intergenic
1035933698 8:3812861-3812883 GTCATTAAACTGGTCCTCGTTGG - Intronic
1037286701 8:17309279-17309301 GTGATTAAACTTATGACCAAAGG + Exonic
1038510378 8:28128652-28128674 GTGATGAAACTGAAGCTGAAAGG - Intronic
1038717266 8:30002878-30002900 GTGATTAAACTATTGCTAAGAGG - Intergenic
1038901091 8:31844629-31844651 GTGAGTAAACTGATGCTCAAAGG - Intronic
1044369489 8:91391724-91391746 GTGTTTAAAATGAAGCTCCTAGG - Intronic
1044568650 8:93693505-93693527 ATAATTAGACTGATGCTAATAGG + Intergenic
1045040115 8:98215597-98215619 GTGAGGAAACTGAGGCTCAGAGG + Intronic
1045304604 8:100948532-100948554 GTAATGTAACTGATACTCATAGG + Intronic
1046778627 8:118191350-118191372 TTGCTTAAACTCATGCTCGTAGG - Intronic
1048604789 8:135956429-135956451 GTGAGGAAACTGAGGCTCAAAGG + Intergenic
1049420087 8:142512640-142512662 GTGAGGAAACTGAGGCTCAGAGG - Intronic
1050629222 9:7541223-7541245 GTAAGCAAACTGATGATCATGGG - Intergenic
1050770484 9:9192420-9192442 GTGATTAAAAGGTTTCTCATAGG + Intronic
1053297290 9:36923982-36924004 ATGAATAAACTGAGGCTCAAGGG + Intronic
1053654743 9:40205599-40205621 GTGATAAAACTGAAGCTTAGAGG - Intergenic
1053905133 9:42834814-42834836 GTGATAAAACTGAAGCTTAGAGG - Intergenic
1054366858 9:64351816-64351838 GTGATAAAACTGAAGCTTAGAGG - Intergenic
1054529855 9:66170711-66170733 GTGATAAAACTGAAGCTTAGAGG + Intergenic
1054674487 9:67841558-67841580 GTGATAAAACTGAAGCTTAGAGG - Intergenic
1055489075 9:76786256-76786278 ATCTTTGAACTGATGCTCATAGG + Intronic
1056564794 9:87761721-87761743 GTGATGAAACTGAGGCTCAGAGG + Intergenic
1060412402 9:123408497-123408519 ATGATGAAACTAATGCTCAGAGG + Intronic
1060691488 9:125664942-125664964 GTGAGAAAACTGGTGCTCAGAGG - Intronic
1061008838 9:127943529-127943551 GTGAAGAAACTGAGGCTCAGAGG + Intronic
1187424714 X:19166749-19166771 TTGAATTAACTGATGCACATGGG + Intergenic
1191967626 X:66777318-66777340 GTGATTACACTGAGGCTATTCGG - Intergenic
1192145718 X:68680950-68680972 GTGAGGAAACTGAGGCTCAGAGG + Intronic
1192415152 X:70973121-70973143 GTGATTAAAATGAAGCTGCTAGG + Intergenic
1193212835 X:78827861-78827883 GTGAAGAAACTGAGGCTCAATGG - Intergenic
1194766664 X:97849532-97849554 ATGAGTAAACTGAGGCTCAACGG - Intergenic
1197417903 X:126197744-126197766 ATGATGAAACTGAAGCTCAAAGG - Intergenic
1198984915 X:142440014-142440036 ATGAGGAAACTGATGCTCAGAGG - Intergenic
1199535756 X:148901123-148901145 ATGAAGAAACTGATGCTCAAAGG + Intronic
1201417209 Y:13759048-13759070 GTGATTGAAATCATGTTCATTGG - Intergenic
1201464203 Y:14262335-14262357 GTTATTAAACTCCTGCTTATAGG - Intergenic