ID: 1030306425

View in Genome Browser
Species Human (GRCh38)
Location 7:108023504-108023526
Sequence CTACATGGTCATTCTCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030306425 Original CRISPR CTACATGGTCATTCTCAGCC AGG (reversed) Intergenic
900546981 1:3234694-3234716 CTACATGGTCATGTTCACCTGGG - Intronic
901055107 1:6445698-6445720 CTACATGGACATGCTGAACCCGG + Exonic
901832126 1:11898951-11898973 CTCCCTGGCCAATCTCAGCCCGG - Intergenic
906103747 1:43279470-43279492 CTACAGGGCCCTCCTCAGCCAGG + Intergenic
907137017 1:52149171-52149193 CTACATGTTCAAGATCAGCCTGG - Intronic
908007260 1:59739717-59739739 CTACATGGTCAATCTCCACGTGG + Intronic
914885735 1:151582890-151582912 CTGCAGGGTCATTCAGAGCCAGG - Exonic
917701078 1:177581953-177581975 CTACAGGTTCATTCTCAACAAGG + Intergenic
918247164 1:182670355-182670377 CTACATGACCTTCCTCAGCCTGG + Intronic
920846996 1:209602335-209602357 TTAGATGGTGATTCTCAACCAGG - Intronic
920975220 1:210779706-210779728 CTAAATGGACATTCTGAGCTGGG + Intronic
922637843 1:227193742-227193764 TTACATGGTAACTCACAGCCAGG + Intronic
923072240 1:230576544-230576566 CTACATGGTAATTCTCAGAGTGG + Intergenic
923617828 1:235552360-235552382 CAACATGGTCATGCCCAGGCTGG + Intronic
1063222912 10:3987533-3987555 CAGCATAGTCATTCTCTGCCTGG + Intergenic
1064145521 10:12823519-12823541 CTGCCAGGTAATTCTCAGCCTGG + Intronic
1068177107 10:53475497-53475519 ATACATGGTCATTTACAGCAGGG - Intergenic
1069678394 10:70266143-70266165 CAACATGTTCATCCTCAACCTGG - Exonic
1073087198 10:100900168-100900190 CTACATGCTGTTTCTAAGCCAGG - Intergenic
1074020074 10:109573414-109573436 CTACGTGATCATTACCAGCCTGG + Intergenic
1074674343 10:115831209-115831231 CCACATGCTCATTCTCTCCCGGG - Intronic
1077856642 11:6132950-6132972 CTAAATGGTCTCTCTCTGCCTGG - Intergenic
1078698984 11:13662762-13662784 CTACATGCTCATCTTCTGCCTGG + Intergenic
1081937638 11:46916600-46916622 CTTCTTGGCCAGTCTCAGCCCGG + Intronic
1083870941 11:65488180-65488202 CCACAGGCTCAGTCTCAGCCTGG - Intergenic
1088949607 11:114554119-114554141 CTATATGGTCATCCTCAGACAGG + Intronic
1089329328 11:117678809-117678831 CTACAAGGCCCTGCTCAGCCTGG - Intronic
1090331971 11:125939486-125939508 CTATATTGTCATTCCCGGCCTGG + Intergenic
1094121104 12:26975219-26975241 TTACCTGGTCATTCTCAGAGGGG - Intronic
1096955922 12:55525987-55526009 CTGCATTGTGATTCTCACCCTGG + Intergenic
1102499070 12:113338724-113338746 CAAAATGGCCTTTCTCAGCCTGG - Intronic
1107346371 13:39465778-39465800 CTTCATGTTCATTCAAAGCCAGG - Intronic
1108706327 13:52991775-52991797 CCACATGGTCAGTCCCAGCCAGG - Intergenic
1111373588 13:87350178-87350200 CTACATGTGCAATCTCAGGCAGG + Intergenic
1114148375 14:20005864-20005886 CCACATGGTGAATCTCACCCTGG + Intergenic
1115624244 14:35173977-35173999 CTACTTGGGCATTCTCAGGATGG + Intronic
1118131983 14:62976553-62976575 CTAGGTGGTCCTTTTCAGCCTGG - Intronic
1118789874 14:69080583-69080605 GTACCTGCTCATTCTCACCCAGG + Intronic
1119307750 14:73621307-73621329 CTATATGGTCATTGCCTGCCTGG + Intergenic
1121877969 14:97471536-97471558 CTAAATGTTCATTCTCAGGATGG + Intergenic
1122268574 14:100558089-100558111 CTTCCTGGTCATTCTCTGGCAGG + Intronic
1122540776 14:102496641-102496663 CACCATGGTCCTTCACAGCCAGG + Intronic
1122629597 14:103101516-103101538 CTCCATGGCCTTTCACAGCCTGG + Intronic
1122710443 14:103653065-103653087 CTACATGGACTTTCTGGGCCAGG + Intronic
1123165113 14:106319011-106319033 CTAAATGAGCATTCTGAGCCAGG - Intergenic
1124578120 15:30927322-30927344 CTTCATGCTCTTTCCCAGCCAGG - Intronic
1125087649 15:35748949-35748971 CTCAATGGTCACTCTGAGCCAGG - Intergenic
1126499530 15:49329929-49329951 ACACATGGTCATTCTAAGCGAGG + Intronic
1127324276 15:57880159-57880181 CTGCATGTTCATTCACAGCTTGG - Intergenic
1128164470 15:65451058-65451080 CAAAATGGACATTCTCATCCAGG + Exonic
1142426066 16:90002985-90003007 CTACATGAAAATTCTCAGCAAGG - Intergenic
1143385677 17:6529024-6529046 CTGCATGCTAATTCTCATCCTGG + Intronic
1145325803 17:21823590-21823612 CTATATGGTCATCCTCAGACAGG + Intergenic
1146984600 17:37203253-37203275 CTACAAAGACATTTTCAGCCAGG - Intronic
1148709817 17:49670420-49670442 TTACAAGGTTATTCTCAACCTGG - Intronic
1149155135 17:53619891-53619913 TTACGTGGTCATTCTCAGTCTGG - Intergenic
1153029873 18:703621-703643 CAGCATGGTCTTTCTCTGCCTGG + Intronic
1153207698 18:2720657-2720679 ATAAATGGTCTTTCTCAGCTTGG - Intronic
1154491474 18:14925455-14925477 CTCCATGGACATTCTCTGGCAGG - Intergenic
1155647622 18:28098779-28098801 CTACTTGTTCATTCTCAGGTGGG + Intronic
1156056483 18:33011011-33011033 CTACATAGTCATTCTCAGTTTGG + Intronic
1158287051 18:55895562-55895584 CTTTTTGGTAATTCTCAGCCTGG + Intergenic
1158917763 18:62152462-62152484 CTCAATGGACTTTCTCAGCCAGG - Intronic
1160236893 18:77093072-77093094 CAGCATGGGCATTCTCGGCCTGG - Intronic
1163545233 19:17937454-17937476 CTAGATGGTCATTCTCACCGTGG + Intronic
1164537589 19:29097829-29097851 CTACAGTGTCATTCTCATCAAGG - Intergenic
1167191362 19:47992113-47992135 CTTCCTGGTCTTTGTCAGCCAGG + Exonic
1168061776 19:53897122-53897144 CTGCAGTGTCAGTCTCAGCCTGG + Intronic
928021977 2:27712570-27712592 GTACATGACCATTCTCACCCAGG - Intronic
928878673 2:36071765-36071787 CTCCAAGGTCCTTTTCAGCCAGG - Intergenic
935311827 2:101791739-101791761 CAACATGGTCATCTTCAGCATGG + Intronic
935338284 2:102036652-102036674 CAAGAAGGTCATTCTCACCCAGG - Intergenic
937760470 2:125595755-125595777 ATACATGTGCTTTCTCAGCCAGG - Intergenic
940661385 2:156549434-156549456 ATACACGGTCATTCTCAGCCAGG - Intronic
944446476 2:199795768-199795790 CTCCATTGTCATTTTCAGCTTGG - Intronic
945816065 2:214606281-214606303 CCAGATGATCATTCTCACCCGGG - Intergenic
948707702 2:239805228-239805250 CTACAGGGTGATGCTCAGCGAGG + Intergenic
1173075114 20:39810969-39810991 CTGTATGGTCATTGTCAGCTTGG + Intergenic
1174428815 20:50452653-50452675 GAAAATTGTCATTCTCAGCCGGG - Intergenic
1175507692 20:59497580-59497602 CTAAATGGTCACCCACAGCCAGG - Intergenic
1177590417 21:23157728-23157750 CTACATTGTGATTCTCATCTGGG + Intergenic
1179068629 21:38051122-38051144 CGCCATGGTCAATCTCAGCCAGG - Intronic
1179578810 21:42325101-42325123 ATACATGGTCATGCACAGACGGG - Intergenic
1180045994 21:45305711-45305733 CTTCATGCTCATCCTCAACCTGG + Intergenic
950095379 3:10326409-10326431 CTCCATGTTCATTCGGAGCCAGG - Exonic
954576466 3:51678959-51678981 CTCCATGGTTATTTTCTGCCAGG + Intronic
954972898 3:54666002-54666024 CCAAATACTCATTCTCAGCCTGG - Intronic
967099720 3:186206533-186206555 CTACAAGGTTATTCTGGGCCTGG + Intronic
968510165 4:992059-992081 CTACAGGGTGGTTTTCAGCCAGG - Intronic
969301860 4:6301685-6301707 CTCCATGGTCAAGCTCATCCTGG + Exonic
971009561 4:22418509-22418531 CTACCTGGTCATTCTCAAGCAGG - Intronic
975568331 4:75784629-75784651 CAACATGGTCTTTATCAGCCCGG + Intronic
975615004 4:76237309-76237331 CTGAATGGACTTTCTCAGCCAGG - Intronic
978257166 4:106706545-106706567 CTCCATTGTCATGATCAGCCAGG + Intergenic
982377936 4:154715158-154715180 CTGCAAGGTGATTCTCAACCTGG + Intronic
982497820 4:156113057-156113079 CTTAATGGTCATTTTCAGACTGG - Intergenic
990677082 5:58199253-58199275 CCACATGGTCTTTTTCAGCATGG - Intergenic
991194801 5:63920297-63920319 CACCAAGGTCATTCACAGCCTGG - Intergenic
992742493 5:79788039-79788061 CTTCATGTTCATTCTCAGAAGGG - Intronic
992786486 5:80175043-80175065 CTTCATGGTCTTTTGCAGCCTGG - Exonic
997880794 5:137587653-137587675 TTCCCTGCTCATTCTCAGCCTGG - Intronic
998018562 5:138752179-138752201 CTACATGCTCACTATCATCCTGG - Intronic
998190004 5:140015621-140015643 CTGCATGGCCACTCCCAGCCTGG + Intronic
999260704 5:150237118-150237140 CTTCCTGGTCATTCCCAACCTGG - Intronic
999459464 5:151745450-151745472 CTACATGGGCAGTGGCAGCCAGG + Intronic
1005902094 6:30225576-30225598 CCACATGGTCCTACCCAGCCTGG - Intergenic
1014199783 6:118596019-118596041 TGACATGGTAATTCTCAGCTGGG + Intronic
1018561361 6:165103738-165103760 CTGAATGGACTTTCTCAGCCAGG - Intergenic
1021317100 7:19161658-19161680 CTAACTGGTCATTCTGAGACAGG - Intergenic
1023477665 7:40598595-40598617 CTGCATGCTCATTCTCACTCTGG - Intronic
1025244759 7:57308757-57308779 CTACATGATGTTTCCCAGCCCGG - Intergenic
1025245840 7:57316580-57316602 TAAGATTGTCATTCTCAGCCAGG + Intergenic
1025589703 7:62841739-62841761 CCAAATGTTCATTCTCAGACTGG - Intergenic
1026286810 7:68970571-68970593 TTTCATAGTCATTCTCAGACAGG - Intergenic
1028420841 7:90631274-90631296 TTACATGGTGACTCTTAGCCAGG + Intronic
1030306425 7:108023504-108023526 CTACATGGTCATTCTCAGCCAGG - Intergenic
1032467329 7:132154170-132154192 CTACAGCCTCCTTCTCAGCCCGG - Intronic
1038356695 8:26835896-26835918 GTACATGGTGATCCTCACCCTGG - Intronic
1039376736 8:37041963-37041985 CTACATGGGCATTGTCACCCAGG - Intergenic
1041152951 8:54955293-54955315 CTACATTCTTATTCTCACCCTGG + Intergenic
1041853370 8:62419389-62419411 CTACATGGTCTCTCCCACCCAGG + Intronic
1042670674 8:71259570-71259592 CTACATTGTCATTTGAAGCCAGG - Intronic
1045324853 8:101110282-101110304 CTGCATGGTCACACACAGCCTGG - Intergenic
1049196485 8:141318460-141318482 CAACAGGGTCAGGCTCAGCCGGG + Intergenic
1053154664 9:35768601-35768623 CTCCAGGGTCTCTCTCAGCCTGG - Intergenic
1054748772 9:68883044-68883066 ATACATGGTCACTCTTTGCCAGG + Intronic
1055302639 9:74898299-74898321 TTAAATGCTCATTCTCAGCAAGG - Intergenic
1055478991 9:76691387-76691409 CTACCTGGTCAGTTTCAACCAGG - Intronic
1058504969 9:105657591-105657613 CAACCTAGTCATTCTTAGCCTGG + Intergenic
1060005085 9:119992658-119992680 CAACATGGTGTTTCTTAGCCAGG + Intergenic
1061269266 9:129527753-129527775 CTACAGGTTCATACTAAGCCTGG - Intergenic
1187730703 X:22251214-22251236 CTAAATGGTTATTCTGAGACTGG + Exonic
1191886683 X:65895655-65895677 CCAAATTGACATTCTCAGCCAGG + Intergenic
1192227598 X:69239731-69239753 CTACATGCCCTATCTCAGCCAGG - Intergenic
1192547074 X:72023105-72023127 CTGAATGTTCATTCTCTGCCAGG + Intergenic
1193103383 X:77640904-77640926 CTTCTTGGTCATGCTCTGCCTGG - Intronic
1196871600 X:120117589-120117611 CTTCATGGTGATTCTGAGCATGG + Intergenic
1197199937 X:123739884-123739906 ATACCTGCTTATTCTCAGCCAGG - Intergenic
1197891004 X:131270307-131270329 CTACAAGGGCTTTCTGAGCCTGG + Intergenic