ID: 1030309941

View in Genome Browser
Species Human (GRCh38)
Location 7:108059023-108059045
Sequence CAGCAGTACGACAGGCCTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 60}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030309941_1030309945 -6 Left 1030309941 7:108059023-108059045 CCCCGAGGCCTGTCGTACTGCTG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1030309945 7:108059040-108059062 CTGCTGATTGACCCAATTGTTGG 0: 1
1: 0
2: 1
3: 5
4: 92
1030309941_1030309946 -5 Left 1030309941 7:108059023-108059045 CCCCGAGGCCTGTCGTACTGCTG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1030309946 7:108059041-108059063 TGCTGATTGACCCAATTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030309941 Original CRISPR CAGCAGTACGACAGGCCTCG GGG (reversed) Intronic
900294773 1:1943388-1943410 CAGCAGGAGGACAGGCGCCGCGG + Intronic
902249895 1:15147447-15147469 CAGCAGTAATCCAGGCCTCCTGG + Intergenic
903545298 1:24120243-24120265 CAGCAGGACGGCAGGACTCTAGG - Exonic
907675018 1:56510166-56510188 CAGCAGGAGGACAGCCCGCGGGG - Intronic
909535122 1:76727641-76727663 CAGCAGTAGGGCAAGCCTGGAGG - Intergenic
916572516 1:166040012-166040034 CAGCAGAAAGGCAGGCCTGGGGG + Intergenic
917692922 1:177487568-177487590 CAGCAGTAGGACTGGGCTAGGGG - Intergenic
922469647 1:225868058-225868080 GAGCAGTGGAACAGGCCTCGGGG + Intronic
922619316 1:226980513-226980535 CACAAGTACCACAGGCCTAGGGG + Intronic
922707487 1:227796942-227796964 CTGCAGCAGGCCAGGCCTCGAGG - Intergenic
1064408355 10:15084245-15084267 CAGCAGTCCGTGAGGCCCCGTGG - Intronic
1083185124 11:61013044-61013066 CAACAGTATCACAGGCCTTGAGG - Intronic
1091440274 12:507534-507556 CAGCAGTGCCCCAGGCCACGTGG - Intronic
1107430063 13:40332468-40332490 CAGAAGTACCAGAGGCCTTGGGG + Intergenic
1121716928 14:96083094-96083116 CAGCCGTGGGACAGGCCTCATGG - Intronic
1123040694 14:105489097-105489119 CAGCAGGCCGAGAGGCCTGGGGG + Intronic
1123692505 15:22850309-22850331 CAGAAGTAAGAGAGGCCTCTAGG + Intronic
1124151163 15:27179637-27179659 CGGCAGGACAACAGGACTCGAGG - Intronic
1136378620 16:29880091-29880113 AAGCATTAGGACAGGCCTCAAGG + Intronic
1137606155 16:49788072-49788094 CAGGACTAGGACAGGCCTTGGGG - Intronic
1152891967 17:82887274-82887296 AAGCAGTAGCACAGGCCTCTCGG - Intronic
1153074702 18:1148889-1148911 CACCACTACCACAGGCCACGGGG - Intergenic
927146725 2:20171045-20171067 CAACAGAACAAGAGGCCTCGTGG + Intergenic
929687797 2:44049345-44049367 CAGCAGTACCACAGCACTCATGG - Intergenic
932845811 2:75135069-75135091 CACCAGTAAGACAGGCCACAGGG - Intronic
934650450 2:96088527-96088549 CAGCAGTACCACAGACCTGCTGG + Intergenic
934959024 2:98651137-98651159 CAGCAGTAGGGCAGGTCTAGTGG - Intronic
935929765 2:108111814-108111836 CAGGAGCAAGACAGGCCTGGTGG + Intergenic
947875034 2:233462209-233462231 CAGCAGGACGACAGGGATCGTGG - Intronic
1173160454 20:40648255-40648277 CAGCAGAGTGGCAGGCCTCGTGG + Intergenic
1178557978 21:33610441-33610463 AAGAAGTACGACAGGCGTGGTGG - Intronic
1182083097 22:27543087-27543109 CAGCTGCACCACAGGCCTCCAGG + Intergenic
1183587126 22:38759321-38759343 CAGGAGTAGGAGAGGCCTTGGGG - Intronic
1183673869 22:39289267-39289289 CAGCAGTGGGACAGGCCACATGG - Intergenic
1184066700 22:42125553-42125575 GAGCAGGAAGACAGGACTCGGGG + Intergenic
1184069168 22:42137705-42137727 GAGCAGGAAGACAGGACTCGGGG + Intergenic
1184536567 22:45091640-45091662 CAGCAAGACAACTGGCCTCGGGG + Intergenic
950796192 3:15512306-15512328 CAGCTGAAGGAGAGGCCTCGTGG - Intronic
953923449 3:46967717-46967739 CAGCTGTATGACAGGCCCTGGGG - Intronic
956592888 3:70933964-70933986 AAGCTGTAAGACAGGACTCGTGG + Intergenic
956608845 3:71101304-71101326 GAGCAGTACAACAGGTCTGGAGG + Intronic
957227117 3:77463829-77463851 CAGCACTTTGACAGGCCACGAGG - Intronic
961661411 3:128470580-128470602 CAGCAGGGCTACAGGCCTCATGG - Intergenic
967968724 3:194984125-194984147 CAGCAGGGCGACAGGCCCAGTGG - Intergenic
969568242 4:7992761-7992783 CAGCAGGAGGAGAGGCCCCGGGG - Intronic
969613711 4:8240560-8240582 CAGCAGTGTCACAGGCTTCGGGG + Intronic
972283294 4:37623701-37623723 CAGGAGTACGGCAGGCATCACGG + Intronic
975640883 4:76499183-76499205 CAGAAATACCACAGGCCTTGTGG + Intronic
994164555 5:96595434-96595456 CAGCAGAACTCCAGGCCTCAGGG + Intronic
1002068123 5:176662661-176662683 CAGCATTACCACAGGTCTGGCGG + Intergenic
1004122267 6:12835395-12835417 TTGCAGTACGACAGGCCTGAAGG + Intronic
1010590849 6:77710206-77710228 CAGCACTACTACAGGCCTGCCGG - Intronic
1018736396 6:166689938-166689960 CAGCAGGACCAGAGGCCTCCTGG - Intronic
1026001885 7:66566167-66566189 CACCAGTAAGACAGGCCTCTCGG - Intergenic
1026030909 7:66793088-66793110 CACCAGTAAGACAGGCCTCTCGG + Intronic
1026840625 7:73668330-73668352 CCGCTGTAGGACACGCCTCGCGG - Intronic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1028470300 7:91198509-91198531 ATGCAGTACTACAGGCCTCTTGG + Intronic
1030309941 7:108059023-108059045 CAGCAGTACGACAGGCCTCGGGG - Intronic
1037554884 8:20012712-20012734 CAGCAGTTCCACATGACTCGAGG + Intergenic
1038797512 8:30722933-30722955 CAGCAGTTGGAGAGGCCTAGGGG - Intronic
1042823777 8:72959922-72959944 CAGCATTACTACAGACCTGGTGG - Intergenic
1049923018 9:382613-382635 CAGCAGTAACCCAGACCTCGCGG + Exonic
1057608485 9:96519226-96519248 ATGCAGAACGACAGGCCTCATGG + Intronic