ID: 1030313986

View in Genome Browser
Species Human (GRCh38)
Location 7:108095540-108095562
Sequence CCTCATGTAGTTTTACTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030313982_1030313986 -1 Left 1030313982 7:108095518-108095540 CCTGTGTCAGGCACTTCCAGAGC 0: 1
1: 0
2: 0
3: 12
4: 186
Right 1030313986 7:108095540-108095562 CCTCATGTAGTTTTACTGGATGG 0: 1
1: 0
2: 0
3: 5
4: 107
1030313980_1030313986 14 Left 1030313980 7:108095503-108095525 CCTCACAGAGGAAATCCTGTGTC 0: 1
1: 0
2: 1
3: 18
4: 158
Right 1030313986 7:108095540-108095562 CCTCATGTAGTTTTACTGGATGG 0: 1
1: 0
2: 0
3: 5
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030313986 Original CRISPR CCTCATGTAGTTTTACTGGA TGG Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
904845424 1:33409974-33409996 CCTCATGTATTTTCTCTGGAAGG + Intronic
905991451 1:42340706-42340728 CATCTTGTAGTTTTACTGTAAGG - Intergenic
911600929 1:99847732-99847754 AGTCATGTATTCTTACTGGAAGG - Intergenic
911716441 1:101138882-101138904 ACTCATGTAGTTCTGCTGAATGG + Intergenic
918180095 1:182080005-182080027 CCCCATGTAGCTTAATTGGATGG - Intergenic
1063254830 10:4315740-4315762 TCTCCTGTGTTTTTACTGGAAGG + Intergenic
1065555474 10:26911299-26911321 CCTCAGGTAGTTTTTTTGGGGGG - Intergenic
1065730992 10:28709497-28709519 CCTCTTAAAGTCTTACTGGATGG + Intergenic
1065774364 10:29105759-29105781 GCTGATGTTGTTTCACTGGAAGG + Intergenic
1067109757 10:43391937-43391959 GATCATGCAGTTTTAATGGAGGG - Intronic
1070518960 10:77235340-77235362 CCTCATCAAGTTTTACAGAAAGG + Intronic
1071883441 10:89924276-89924298 CCCCATGAAGATTTACTGAATGG + Intergenic
1072106219 10:92276795-92276817 CCTCATGTACTATTAGTGGGAGG - Intronic
1076674174 10:132139778-132139800 CCTGAGGGAGTTTTGCTGGAAGG + Intronic
1083813963 11:65121622-65121644 GCTCATGTAGCCTCACTGGAGGG - Exonic
1086599639 11:88617206-88617228 TCCCATGTAGTTTTATTAGATGG - Intronic
1091985724 12:4909346-4909368 TTCCATGTAGTTTTACTGGGCGG - Intergenic
1092353330 12:7773992-7774014 CCTCATTTAGTTCTACTCCACGG - Exonic
1093209705 12:16293460-16293482 GCTCAGGTCGTTTTTCTGGATGG - Intergenic
1093764832 12:22951681-22951703 CCTTATGTAGGTAGACTGGACGG + Intergenic
1094737886 12:33255833-33255855 CTTAATGTAGATTTAATGGAGGG - Intergenic
1094765603 12:33590833-33590855 CCTTAGGTAGTTTTACAGGTGGG - Intergenic
1095807159 12:46332154-46332176 CCACATCTTGTCTTACTGGAGGG + Intergenic
1099446339 12:82756435-82756457 CCTCACGCAGCTTTACTGGCAGG - Intronic
1100036555 12:90259151-90259173 CCTCAGGTAGTTTGTCTGAAAGG - Intergenic
1102665877 12:114572376-114572398 CCTCCTATAGTTTTATTGGGGGG - Intergenic
1103505238 12:121438602-121438624 CCTCATGAAGTTTTGGTGGCAGG - Intronic
1104800813 12:131554326-131554348 CCTCTTGGAGATTTCCTGGAGGG - Intergenic
1108380599 13:49850538-49850560 CCTTATGTGGTATCACTGGAAGG - Intergenic
1108895091 13:55316365-55316387 CCTCAGGTAGCTTTGCTGAAGGG - Intergenic
1110903217 13:80850994-80851016 CCACATGTTGTCTTTCTGGAAGG - Intergenic
1111627043 13:90801386-90801408 CCTCTTTTCGTTTTGCTGGAAGG + Intergenic
1112932034 13:104752910-104752932 CCTCATACAATTTTACGGGAGGG + Intergenic
1117645287 14:57845134-57845156 CCTCCTGAAGTTCTACAGGATGG - Intronic
1118281428 14:64432517-64432539 GCTCATTTATTTTTATTGGATGG - Intronic
1130772784 15:86941666-86941688 CCTGGTGAAGTTTTCCTGGAGGG - Intronic
1133588363 16:7217423-7217445 CCTGCTGTAGTTTTCCTGGCTGG - Intronic
1143557954 17:7674249-7674271 ACACATGTAGTTGTAGTGGATGG + Exonic
1145755663 17:27388456-27388478 CCTCAAGGAGTTTTTTTGGAAGG + Intergenic
1147011024 17:37448136-37448158 CCTCATTTAGAACTACTGGAAGG + Intronic
1147665126 17:42142109-42142131 CCCCATGCAGATTTATTGGATGG - Intronic
1149891774 17:60395999-60396021 CCTCATATTGTTTGACTGTAAGG - Intronic
1150826338 17:68479048-68479070 CTCCATGTAGATTTACTGTAGGG + Intergenic
1152670284 17:81600045-81600067 CCTCATGAAGTGTGGCTGGAAGG + Intronic
1153920141 18:9781811-9781833 ACACATGCAGTTTTCCTGGAAGG + Intronic
1155936649 18:31761545-31761567 CCACATGAAATTTTACTGGGAGG + Intergenic
1159938866 18:74390200-74390222 GCTCATGTAGCCTCACTGGAGGG - Intergenic
1163689897 19:18732788-18732810 CCTCCTGTAGTTATTCTGAAAGG - Intronic
928976018 2:37087261-37087283 CTTCATGTGGTTTTAGTGGAGGG - Intronic
931017821 2:58006105-58006127 ACTCAAGTAGTTCTTCTGGAGGG - Intronic
932383833 2:71312086-71312108 GGTCATGTGTTTTTACTGGATGG + Intronic
935177285 2:100660825-100660847 CCTCATTTAGTTCTACTCCACGG - Intergenic
936857903 2:116982225-116982247 CCCCATGTAGTCTAACTGGGAGG + Intergenic
939516091 2:143169935-143169957 CATCATGAAGATTTACTTGAGGG - Intronic
942069141 2:172299604-172299626 ACTCAGGCAATTTTACTGGAAGG - Intergenic
1176020275 20:62959092-62959114 CCTCATCTTTGTTTACTGGAGGG + Intronic
1176519089 21:7811703-7811725 CCTCATGCAGTTTCACAGCAAGG - Intergenic
1178653117 21:34441716-34441738 CCTCATGCAGTTTCACAGCAAGG - Intergenic
1179204323 21:39259948-39259970 CCTCATATAGTATTATGGGATGG + Intronic
949179204 3:1106817-1106839 TCACATGTATTTTTACTGCATGG + Intronic
950180816 3:10911974-10911996 CCTTATGGAGTTTTTCTGAAGGG + Intronic
950880630 3:16320166-16320188 CTTCAAGTAGTTTAGCTGGAAGG + Intronic
951561693 3:23973944-23973966 CCACATTTTGTTCTACTGGAAGG + Intronic
952197625 3:31092763-31092785 CTTCATGTAGTTTTTCTACAGGG - Intergenic
956715647 3:72077520-72077542 CCTAATGGAGTTTTTCTGGTTGG - Intergenic
957544639 3:81621830-81621852 CCTCATTCACTTTCACTGGATGG + Intronic
960619514 3:119625134-119625156 CCTCGTGGAGTTTCACTTGAAGG + Exonic
962265355 3:133940590-133940612 CCTCATGTAGTTTTATGTCAGGG + Intronic
964662548 3:159136374-159136396 CCACATCTGGTTTTTCTGGATGG + Intronic
972107847 4:35513968-35513990 CTTCATGTAGTTTTCAAGGAAGG - Intergenic
976229388 4:82825467-82825489 TCTCAGGAAATTTTACTGGAAGG + Intronic
977862976 4:101988933-101988955 CCTCACCTAGCTTTACTGAAAGG + Intronic
979765151 4:124455582-124455604 CCACATGTTGTCTCACTGGAAGG + Intergenic
982242096 4:153310010-153310032 CCTTATGTAATCTTCCTGGAGGG + Intronic
983094707 4:163547845-163547867 CATCATGTAATTTTCCTTGAAGG + Intronic
987484406 5:18506325-18506347 CCACATGTTGTCTCACTGGAAGG - Intergenic
987815354 5:22893907-22893929 CCACATGTAGCTTTACTATAAGG - Intergenic
993245730 5:85450684-85450706 CATCATGAAGTTTTAATGGAGGG - Intergenic
997690071 5:135822275-135822297 ACTCATGTGGGTTTGCTGGATGG - Intergenic
999285558 5:150392311-150392333 CCTCATGAAGTTGTACAGGTGGG - Intronic
999531191 5:152465177-152465199 CCTTATGCAGCTTCACTGGAGGG + Intergenic
1000782084 5:165494755-165494777 CCTCATGAAATTTTACTGATAGG + Intergenic
1003569234 6:7245604-7245626 CCACATACAGTTTTACTGGGTGG + Intronic
1005852951 6:29835863-29835885 CATCATGAAGTTCTCCTGGAGGG + Intergenic
1008801747 6:55377095-55377117 CCACATGTAGTGCTACTGGCTGG + Intronic
1013112256 6:107073439-107073461 CATCATGCAGTTTGACAGGATGG - Intronic
1014403557 6:121021036-121021058 CCTCATGTATATTTACAGAATGG + Intergenic
1019874317 7:3795362-3795384 CCTCCTGCAGTATTGCTGGAAGG + Intronic
1021207643 7:17804916-17804938 CCTCTTCTAGTTTTTCTTGATGG - Intronic
1026295319 7:69047128-69047150 CCTCATTTAGAATTACAGGAAGG + Intergenic
1026428788 7:70323393-70323415 CCTCATGAAGTGGTATTGGAAGG + Intronic
1030313986 7:108095540-108095562 CCTCATGTAGTTTTACTGGATGG + Intronic
1030970359 7:116047720-116047742 CCTCAAGTAGCTTAACTGGGAGG + Intronic
1033337141 7:140463532-140463554 CTGCATGAAGTTCTACTGGATGG + Intronic
1033968019 7:147002033-147002055 CCTTATGTTGTTTTACTTAATGG - Intronic
1036985315 8:13522290-13522312 CCTCATGTAGCTTAAATGGGGGG + Intergenic
1041773406 8:61497325-61497347 GTTCATGTGATTTTACTGGAAGG - Intronic
1043491861 8:80757217-80757239 CCACATCTTGTTCTACTGGAAGG - Intronic
1045487721 8:102645399-102645421 CCTCATGAAGTTTTACAGTCAGG + Intergenic
1045866727 8:106874694-106874716 CCTCATGCAGATTTACTGTCTGG + Intergenic
1052803686 9:32993401-32993423 GTTTATGGAGTTTTACTGGAGGG - Intronic
1053372642 9:37575941-37575963 CGTCCGGTAGTTTTACGGGAGGG + Intronic
1054793340 9:69276200-69276222 TCTCATGTGGTTTTTCTGTAAGG + Intergenic
1055896608 9:81184360-81184382 CCTAAGGTAGTTTTACAGTAAGG - Intergenic
1057327687 9:94080759-94080781 CAACATGTCGTTTTACTGTAAGG + Intronic
1057843728 9:98506181-98506203 CCTCATGGAGCTTCAGTGGAGGG + Intronic
1188736237 X:33719934-33719956 TCTCATTTATTTTGACTGGAGGG - Intergenic
1192861181 X:75073036-75073058 CCACATCTCGTTTTACTGGAAGG + Intronic
1196366477 X:114930093-114930115 CATCATGTAGTTTACATGGAAGG + Intergenic
1197342067 X:125286929-125286951 CCTCATGTTGTTGCTCTGGAGGG + Intergenic
1197646311 X:129021424-129021446 CCTTAAGTAGGTTTACTGCATGG - Intergenic
1197923495 X:131621510-131621532 CCTCTTATAGTGTTGCTGGAAGG + Intergenic