ID: 1030314335

View in Genome Browser
Species Human (GRCh38)
Location 7:108098471-108098493
Sequence CTTTGTAAAGAGAACGTGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030314335_1030314344 17 Left 1030314335 7:108098471-108098493 CCTTCCACGTTCTCTTTACAAAG 0: 1
1: 0
2: 1
3: 7
4: 166
Right 1030314344 7:108098511-108098533 ACCCTAAGGCAGGATCAGAGTGG 0: 1
1: 0
2: 3
3: 12
4: 150
1030314335_1030314340 3 Left 1030314335 7:108098471-108098493 CCTTCCACGTTCTCTTTACAAAG 0: 1
1: 0
2: 1
3: 7
4: 166
Right 1030314340 7:108098497-108098519 CTGGCCGGCCACAGACCCTAAGG 0: 1
1: 0
2: 0
3: 5
4: 101
1030314335_1030314342 7 Left 1030314335 7:108098471-108098493 CCTTCCACGTTCTCTTTACAAAG 0: 1
1: 0
2: 1
3: 7
4: 166
Right 1030314342 7:108098501-108098523 CCGGCCACAGACCCTAAGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030314335 Original CRISPR CTTTGTAAAGAGAACGTGGA AGG (reversed) Exonic
901662544 1:10807628-10807650 CATAGCAAAGAGAACATGGAAGG - Intergenic
905366754 1:37455875-37455897 CTTCATAAAGAGAATTTGGAGGG - Intergenic
905856227 1:41316558-41316580 CTTGGTAAAGAGGACGAGAAGGG + Intergenic
908415075 1:63905113-63905135 CTTAGTGCAGAGAACATGGAGGG + Intronic
909127639 1:71694651-71694673 CTATATATAGTGAACGTGGAAGG + Intronic
911380342 1:97106408-97106430 CTGAGTAAAGAGAATGTGGGCGG + Intronic
911656211 1:100446940-100446962 CTTTGGAAAGACAAGGTGGGCGG - Intronic
914227405 1:145732280-145732302 CTTTGAAAAGATCACATGGAAGG - Intronic
914986516 1:152461857-152461879 CATTGAAAAGAGAGCGTGTAGGG - Intergenic
916906941 1:169296248-169296270 CTTTGTAAGGTGAATGTTGATGG - Intronic
916941083 1:169679225-169679247 TTTAGTAAAGAGAAGGTGGGTGG - Intronic
918836883 1:189476816-189476838 CAATGTAAAGAAAAAGTGGAGGG + Intergenic
918918588 1:190674771-190674793 CTTTGTCCAGAGAACTTAGAAGG + Intergenic
919348791 1:196421279-196421301 CTTTGTAATGTGAATTTGGAAGG - Intronic
920848282 1:209611531-209611553 CTTTGCTAAGAGCAAGTGGAGGG + Exonic
920905870 1:210167079-210167101 CATTGTAAAGATAACTTAGAAGG - Intronic
921284334 1:213595482-213595504 CTTTGCAAAGGAAACGTGGTTGG - Intergenic
921680475 1:218025149-218025171 CTGTGTTAAGATAACGTGCAAGG - Intergenic
922310109 1:224380855-224380877 CTTTGGAAAGACAAGGTGGGAGG + Intergenic
1063476893 10:6336672-6336694 CTTTGTGAAGCCAAGGTGGATGG - Intergenic
1066031053 10:31425429-31425451 GTTTCTAAAAAGAACGTGGTTGG + Intronic
1071080959 10:81810551-81810573 CTTTTTAAAGAAATCATGGAAGG - Intergenic
1071368096 10:84922058-84922080 CTTAGTAAAGAGCAGGTGCAGGG + Intergenic
1073825400 10:107314968-107314990 CGTTGTAAAGTGATAGTGGATGG + Intergenic
1074942486 10:118248745-118248767 CTTTGCAGAGAGCACGTGGTTGG + Intergenic
1075203096 10:120422626-120422648 CTCTGTAAAGAAAGCGTGGCTGG + Intergenic
1078161817 11:8846634-8846656 CTTGGTGAAGAGAACGAGAAAGG - Intronic
1080004944 11:27396907-27396929 CTTTGGAAACAGAACACGGAGGG - Intronic
1081209797 11:40318714-40318736 TTCTGTAAAGAGCAGGTGGAGGG - Intronic
1082293551 11:50411821-50411843 CTTTGGGAAGCCAACGTGGAAGG + Intergenic
1083025260 11:59545404-59545426 GTTTTTAAAGAGAATGTGGTGGG + Intergenic
1090042606 11:123303899-123303921 CTTTGCATAGAGAACCGGGAAGG + Intergenic
1090936076 11:131343748-131343770 CTGAGTAAAGAGAAGTTGGAAGG + Intergenic
1091296408 11:134476972-134476994 CTTTGTGAAGAGAAGGGGGAGGG + Intergenic
1097669172 12:62515570-62515592 CTTTGTAAGGCCAAGGTGGATGG + Intronic
1097719737 12:63007220-63007242 CTTTGTAACAAGAATCTGGAGGG + Intergenic
1099481443 12:83171432-83171454 CTTTGTTAAAAGAAAGTAGACGG + Intergenic
1099738209 12:86597787-86597809 CTTTTTAAAGGGATTGTGGATGG - Intronic
1105276546 13:18933649-18933671 CTTTTTAAAGAGACTGTGGGTGG + Intergenic
1105841763 13:24259881-24259903 CTTTGTAAAGCCAAGGTGGGAGG - Intronic
1106295823 13:28412856-28412878 CTGTTTTAAGAGAACGTGGCCGG - Intronic
1107855381 13:44610462-44610484 CTTTGGGAAGAAAAGGTGGATGG + Intergenic
1108804196 13:54133460-54133482 CTTTCTAAAGACGACATGGATGG - Intergenic
1110311499 13:74055576-74055598 CTTTGTAAAAACACTGTGGAAGG - Intronic
1112400742 13:99076187-99076209 TTTTGCAAGGAGCACGTGGATGG - Intronic
1114919992 14:27313976-27313998 CTTTGTACAGACAATGTGAATGG - Intergenic
1116399435 14:44487705-44487727 CTTTGTAAAGAGGACTGGGCTGG + Intergenic
1116812320 14:49551305-49551327 CTGTGTAAAGTTAACGTGAAAGG + Intergenic
1118790322 14:69085731-69085753 TTTTGTAAAGAGAAGGTAGAGGG - Intronic
1120602230 14:86525381-86525403 CTTTGTATAAAGAAAGTTGAGGG - Intergenic
1121266517 14:92606293-92606315 CTTTGGGAAGACAAGGTGGAAGG + Intronic
1121751354 14:96360093-96360115 CTTTGTAAAGAGAAAGTGAATGG + Intronic
1121856047 14:97271036-97271058 CTTTATAAAGAGAGGATGGATGG - Intergenic
1126711765 15:51465497-51465519 TTTTGTAAAGAGAAACTTGACGG + Intronic
1128371368 15:67041956-67041978 CTTTCTAAAGAGAAGGGGCAAGG + Intergenic
1128830542 15:70763881-70763903 CTTGGTAAAGAGCGCGTGGGTGG - Intergenic
1130116246 15:81006979-81007001 CTTTGCTGAGTGAACGTGGAAGG + Intergenic
1130532357 15:84757197-84757219 CTTTGTGAAGCTAAGGTGGAAGG - Intronic
1134071570 16:11263414-11263436 CTTTGTAAAGAGAACCGAGGAGG - Intronic
1137757437 16:50913864-50913886 CTTTAAAATGAGAAGGTGGAGGG + Intergenic
1137780310 16:51092587-51092609 CTTTGTACAGAGCTCCTGGAGGG + Intergenic
1138122006 16:54407965-54407987 CTATGGGAAGAGAATGTGGATGG - Intergenic
1141184470 16:81777545-81777567 TTTTTTAAAGAGATCTTGGAAGG - Intronic
1149572289 17:57680956-57680978 ATTTGTAAATAGAAAGTGAATGG - Exonic
1151325971 17:73379945-73379967 CTGTGTAAAGAGTTGGTGGATGG - Intronic
1155506457 18:26538277-26538299 CTCTGTAAAGAGAAATAGGAAGG + Intronic
1159568919 18:70089981-70090003 TGTTCTAAAGAGAACATGGAGGG + Intronic
1162527791 19:11216713-11216735 CTTTGTGAATAGAATTTGGAAGG - Intronic
1166189351 19:41165475-41165497 CTTTGTAAGGCGAAGGTGGGCGG + Intergenic
1167196829 19:48034919-48034941 CTTTGGAAGGACAAGGTGGAAGG - Intronic
925006133 2:444543-444565 TGTTGTAAAGAGAACGTAAATGG - Intergenic
926839248 2:17060256-17060278 CTTTCTATTGAGAAGGTGGATGG + Intergenic
927702778 2:25278312-25278334 CATTTTAAAGAGAACTTGGGTGG - Intronic
931063085 2:58553356-58553378 CCTTCTAAAGAGAATGTGGGAGG - Intergenic
931853066 2:66273333-66273355 ATTTGCAAAGAGATCTTGGAAGG - Intergenic
933674465 2:85041964-85041986 CCTAGTAAAGAGAGAGTGGATGG + Intronic
935137886 2:100322808-100322830 ATTTTAACAGAGAACGTGGAGGG + Intergenic
938923883 2:136021107-136021129 CTGGGTCAAGAGAATGTGGATGG + Intergenic
939039228 2:137167866-137167888 CTTTATAAAGTGAACCTGAAAGG - Intronic
940424677 2:153516856-153516878 CTGTGTAAAGAGAAGTGGGAAGG - Intergenic
942442975 2:176055225-176055247 CTTTAAAAAGAGAAGGTGGCAGG - Intergenic
945159384 2:206873692-206873714 CTGTTTAAAGAGAAAGAGGATGG + Intergenic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
948156323 2:235785902-235785924 CCTTTTAAAAAAAACGTGGATGG + Intronic
948562364 2:238863126-238863148 CTTTGTAAAGATAGTGTGGCAGG + Intronic
1169219732 20:3815076-3815098 CTATGTGAATAGAAAGTGGAAGG + Intergenic
1170559852 20:17547608-17547630 GTTTGTAAAAAGAAATTGGATGG + Intronic
1172160359 20:32863725-32863747 CGTTGTAAGGACCACGTGGAAGG - Intronic
1173120179 20:40282029-40282051 CTTTTGAAAGAGAACCTTGAAGG + Intergenic
1181562445 22:23713833-23713855 CTTTGTAAGGAGGACTTGGTAGG - Intergenic
949932941 3:9093717-9093739 CTTTGAAAAGAGATTTTGGATGG - Intronic
950016685 3:9759487-9759509 CTTTGCCAAGAGCAAGTGGAAGG - Exonic
950874806 3:16261985-16262007 CTAGGTAAAGAGAACATGAAGGG - Intronic
952179036 3:30898470-30898492 CTCTCTAAAAAGAACTTGGAAGG + Intergenic
953669554 3:44951295-44951317 CTCTGTGCAGAGAATGTGGAAGG - Intronic
958990807 3:100842178-100842200 GTTTGTAGAGAGGATGTGGAAGG - Intronic
960074239 3:113466027-113466049 TTTTGTAAAAAGAAAGTAGAGGG + Intronic
960535657 3:118812137-118812159 CTTTGCAAAGGGTAGGTGGATGG + Intergenic
961949415 3:130732820-130732842 CTTTGTAAATAGTACGTGTGTGG - Intronic
968076293 3:195817475-195817497 CTGTGTAAGGAGAACGAGGCCGG - Intergenic
970726228 4:19048227-19048249 CTTTGGAAAGCCAAAGTGGAAGG - Intergenic
972985614 4:44760788-44760810 CTTTGTAAAATGAAGGTGGCAGG + Intergenic
973636437 4:52865636-52865658 CTCTTTACAGAGGACGTGGAAGG - Exonic
973648739 4:52976224-52976246 CTTTGTAAAAAGAAAGTGATAGG + Intronic
974595385 4:64008106-64008128 GTTTGTAAAGGGATCCTGGAAGG - Intergenic
974660279 4:64879513-64879535 TTTTATAAAGAGAAGGTGAAGGG - Intergenic
976665805 4:87589807-87589829 ATTTTTAAAGAGATTGTGGAAGG - Intergenic
977008662 4:91607211-91607233 ATTGGTAAAGAGAACATGGCTGG + Intergenic
978737654 4:112102406-112102428 CTTTATAAAGATAAGGTGGGGGG + Intergenic
979309358 4:119184056-119184078 CTTTGGGAGGAGAAGGTGGATGG - Intronic
979410271 4:120368936-120368958 CTTTGTTAAGCTAACGTGCAGGG - Intergenic
980832789 4:138152053-138152075 CTTTGTAAAAGGAAGGTAGAAGG + Intergenic
982219922 4:153115539-153115561 CTTTGGGAAGGGAACGTGAATGG + Intergenic
983635557 4:169894642-169894664 CTTTGGGAAGACAAGGTGGAAGG + Intergenic
985806049 5:2044254-2044276 CATTGTACAGAGAAGCTGGAGGG + Intergenic
988893546 5:35647249-35647271 CTTAGTAAGGAGAAGGGGGAGGG + Intronic
990107462 5:52281840-52281862 CTTTGTAAATAAAACATGAAGGG - Intergenic
992713940 5:79490686-79490708 CTTTGGAAAGCCAAGGTGGAGGG + Intronic
992766458 5:80005509-80005531 CTTTGTAAAAAGAGTGTGCACGG + Intronic
993033583 5:82732357-82732379 GTTTGTCAAGAGAAAGTGCAAGG - Intergenic
994819887 5:104635683-104635705 CTTTGAAAAAAGAACTGGGAAGG - Intergenic
995507978 5:112880296-112880318 CTTGGTAATTAGAAAGTGGAAGG - Intronic
998491479 5:142550944-142550966 CTTTGGAAGGATAAGGTGGACGG - Intergenic
1000215673 5:159153632-159153654 CTTGGGAAAGAGGAGGTGGAGGG + Intergenic
1002804900 6:563533-563555 CTTTGTAAAGAAAACCTTTATGG + Intronic
1003707939 6:8555681-8555703 CTCTGTAAGGAGGAGGTGGAGGG - Intergenic
1006191872 6:32214258-32214280 GGTTGTAAAGAGAAAGGGGAGGG + Intronic
1008307441 6:49920630-49920652 CTTTATTAAGAGAAAGTGAAAGG + Intergenic
1008351206 6:50492393-50492415 CTTTGTAAAGGGACCCTGGGAGG - Intergenic
1011751350 6:90458326-90458348 CTCTATAAAAAGAACGTGTAGGG - Intergenic
1012029947 6:94046296-94046318 CTTTCTGAAGAGAAGGTGGAAGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014345245 6:120262290-120262312 CTTTTTAATGAGAACTTTGAAGG + Intergenic
1016439776 6:144071012-144071034 CTTTGGGAAGAGAATGTGAAGGG - Intergenic
1017152076 6:151289787-151289809 CTTTGTAAAGGGAGGGTGGTGGG + Intronic
1021428698 7:20534678-20534700 CTTTGGAAAGTGCATGTGGATGG + Intergenic
1021453074 7:20799341-20799363 ATTTATAAAGAGAAGGTGGGAGG - Intergenic
1024377305 7:48654394-48654416 CTTGGTGCAGAGAACGTGAAGGG - Intergenic
1024665977 7:51547727-51547749 CTTGGTAAAGAGAAAGGGTAAGG - Intergenic
1029100501 7:98125966-98125988 CTCTGAAGAGAGAACTTGGAAGG + Intronic
1030314335 7:108098471-108098493 CTTTGTAAAGAGAACGTGGAAGG - Exonic
1032693402 7:134312308-134312330 CTTGTTAAAGAGAACATAGAAGG - Intronic
1032954995 7:136960237-136960259 CTTTGTATAGATGATGTGGATGG - Intronic
1033180561 7:139173609-139173631 CTTTTTAAGGAGATGGTGGATGG - Intronic
1034154625 7:148946291-148946313 CTTTGGAAAGAGGCCGAGGAGGG + Intergenic
1034383193 7:150716934-150716956 CTTTGTTAAGGGAATGTGGGAGG - Intronic
1034796058 7:154014753-154014775 CTTTGTTTTTAGAACGTGGAGGG - Intronic
1035404578 7:158588758-158588780 CCTTGGAATGAGAACGTGGCAGG - Intergenic
1035651567 8:1269646-1269668 CTTTGTAAAATGACCTTGGAAGG + Intergenic
1036000287 8:4594882-4594904 CTCTGTAAAAGGAATGTGGATGG + Intronic
1036977611 8:13431759-13431781 CTTGGGAAAGGGAACGTGGGTGG + Intronic
1037848465 8:22305904-22305926 CTTTGAAGAGAGAACGAAGAGGG - Intronic
1038815311 8:30897058-30897080 TTTTGTAAAGACAATTTGGAAGG - Intergenic
1039761889 8:40585498-40585520 CTTTGTAAAGTGCAGGTGTATGG - Intronic
1041691178 8:60688915-60688937 CATGGTAAAGAGAACTTGGGAGG - Intronic
1042134727 8:65622144-65622166 CTTTGGAAAGCCAAGGTGGAAGG + Intronic
1042215215 8:66424421-66424443 TATTGTAAAGTGAACCTGGAAGG - Intergenic
1043169867 8:76952312-76952334 AATTGTAAATAGAAGGTGGAGGG + Intergenic
1043413481 8:80024510-80024532 CTTTGTAAGGATAATGTGTATGG + Intronic
1043515594 8:80992089-80992111 TGTTTTATAGAGAACGTGGATGG - Intronic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1046366620 8:113240155-113240177 CTTTGAAAGGAGGACATGGATGG - Intronic
1047225918 8:122955342-122955364 TTTTGTAAAGATAACTTGGGAGG - Intronic
1048252322 8:132877001-132877023 CATTGTAACCAGAATGTGGAAGG + Intronic
1048395030 8:134006268-134006290 CATTGTAAAAAGGAGGTGGAGGG + Intergenic
1050518725 9:6474253-6474275 GTTTTTAAAGAAAAGGTGGAAGG + Intronic
1056047965 9:82738876-82738898 ATTTGTAAAGAAACCGTGGCTGG - Intergenic
1057077605 9:92146967-92146989 CTCTGTAAAGAGAAATGGGAGGG - Intergenic
1061507838 9:131041698-131041720 CCCTGCAAAGAGAATGTGGAAGG + Exonic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1189648708 X:43164556-43164578 CTTTGTAAAGAGAAAAATGAAGG + Intergenic
1194758926 X:97770874-97770896 CTTTGAAAAGAGAACAGTGAGGG + Intergenic
1195235696 X:102896056-102896078 CTTTGGAAAGGGAACCTGGATGG - Intergenic
1198829023 X:140729213-140729235 TGTTGTAAAGAGAATGTGGGTGG - Intergenic
1201629829 Y:16058808-16058830 ATTTGTAAAAAGAACAAGGAAGG + Intergenic