ID: 1030316780

View in Genome Browser
Species Human (GRCh38)
Location 7:108123975-108123997
Sequence CAGTGGGTCTGGAGAAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030316773_1030316780 29 Left 1030316773 7:108123923-108123945 CCAAGTTACCATTGAAGAGAGTT 0: 1
1: 0
2: 0
3: 16
4: 201
Right 1030316780 7:108123975-108123997 CAGTGGGTCTGGAGAAAAGAAGG No data
1030316772_1030316780 30 Left 1030316772 7:108123922-108123944 CCCAAGTTACCATTGAAGAGAGT 0: 1
1: 0
2: 1
3: 8
4: 122
Right 1030316780 7:108123975-108123997 CAGTGGGTCTGGAGAAAAGAAGG No data
1030316776_1030316780 1 Left 1030316776 7:108123951-108123973 CCAGAGTGGAGTACATATACACT 0: 1
1: 0
2: 2
3: 11
4: 88
Right 1030316780 7:108123975-108123997 CAGTGGGTCTGGAGAAAAGAAGG No data
1030316774_1030316780 21 Left 1030316774 7:108123931-108123953 CCATTGAAGAGAGTTCTGATCCA 0: 1
1: 1
2: 2
3: 9
4: 132
Right 1030316780 7:108123975-108123997 CAGTGGGTCTGGAGAAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030316780 Original CRISPR CAGTGGGTCTGGAGAAAAGA AGG Intronic
No off target data available for this crispr