ID: 1030316933

View in Genome Browser
Species Human (GRCh38)
Location 7:108125675-108125697
Sequence CACTCCCACCTGTCCGATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 80}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030316933_1030316935 0 Left 1030316933 7:108125675-108125697 CCTACATCGGACAGGTGGGAGTG 0: 1
1: 0
2: 1
3: 7
4: 80
Right 1030316935 7:108125698-108125720 AGGCAGACTGCCGAATTCCCAGG No data
1030316933_1030316939 21 Left 1030316933 7:108125675-108125697 CCTACATCGGACAGGTGGGAGTG 0: 1
1: 0
2: 1
3: 7
4: 80
Right 1030316939 7:108125719-108125741 GGACTCAGATTTAGAAAGACAGG No data
1030316933_1030316940 24 Left 1030316933 7:108125675-108125697 CCTACATCGGACAGGTGGGAGTG 0: 1
1: 0
2: 1
3: 7
4: 80
Right 1030316940 7:108125722-108125744 CTCAGATTTAGAAAGACAGGAGG 0: 1
1: 0
2: 1
3: 20
4: 217
1030316933_1030316941 27 Left 1030316933 7:108125675-108125697 CCTACATCGGACAGGTGGGAGTG 0: 1
1: 0
2: 1
3: 7
4: 80
Right 1030316941 7:108125725-108125747 AGATTTAGAAAGACAGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030316933 Original CRISPR CACTCCCACCTGTCCGATGT AGG (reversed) Intronic
902242887 1:15100464-15100486 CTCTCCCACCTGTCAGACCTGGG + Intronic
907413878 1:54301019-54301041 CAGTGCCACCTGTCAGATGTGGG - Intronic
907487803 1:54789277-54789299 CACTCCCAGCTGGGGGATGTGGG + Intronic
908169878 1:61493846-61493868 CACTCCAACCTGGGCGATGCAGG - Intergenic
916498333 1:165365266-165365288 CACTCCCAGCTGTCATCTGTTGG + Intergenic
916784598 1:168076963-168076985 CACTCCCACCTGGCAGGTCTGGG - Intergenic
920052425 1:203171979-203172001 CTCTCCCACCTGGCGGATGTAGG + Exonic
921672741 1:217944694-217944716 CCCTCCCACCTCCCCGATGCAGG + Intergenic
922591386 1:226779813-226779835 CCCTCCCACCTGTCCTGTCTAGG + Intergenic
923377560 1:233379613-233379635 CATTCCCACATGTCTGCTGTAGG - Exonic
924204357 1:241696653-241696675 CACTCCCACCAGTGCCATGACGG - Intronic
1070555347 10:77523032-77523054 CACTCCCACCTGTGGCATGGAGG - Intronic
1071166993 10:82818221-82818243 CACTCCCACCAGTGCCATGACGG - Intronic
1072567666 10:96630971-96630993 CACTCCCACCTGCCTGACCTTGG + Intronic
1079100073 11:17535650-17535672 CCCTCCCACCTGAACCATGTGGG - Intronic
1083255532 11:61493241-61493263 CACTCCCACCTGAGCGATGGAGG - Intergenic
1083863964 11:65443589-65443611 CACTGCCACCTGGGCCATGTGGG + Intergenic
1084218513 11:67664387-67664409 CACCCCCACCTGGCTGCTGTTGG + Exonic
1084269796 11:68022748-68022770 CACCCCCACCTGGCTGCTGTTGG - Exonic
1087361063 11:97160171-97160193 CACTTACACCTGTCACATGTGGG + Intergenic
1088871608 11:113894814-113894836 CACTCCCACCTGTCAGCTGTTGG - Intergenic
1094529553 12:31261059-31261081 CGCCCCCACCTATCCCATGTTGG + Intergenic
1102435173 12:112917334-112917356 CACTTGCACCTGACAGATGTGGG - Intronic
1103984749 12:124759889-124759911 CACTGCCACCTGTGCCATGGGGG - Intergenic
1106112836 13:26792113-26792135 AACTCCCACCTGTCTGAAGGTGG + Intergenic
1113165693 13:107439255-107439277 CACATCCACCTGGCTGATGTTGG + Intronic
1113704902 13:112423598-112423620 CATTCCCTCCTGTGGGATGTTGG - Intronic
1125534221 15:40434083-40434105 TACTCCCACCTTGCCCATGTGGG - Intronic
1126302043 15:47207934-47207956 CACTCCCTCCTGTCCATTATTGG - Intronic
1129137982 15:73571325-73571347 CACTCCCACCTGCCCTTAGTAGG - Intronic
1129159757 15:73740687-73740709 CACTCACACCTGGCTGATGCAGG - Intronic
1131485716 15:92818758-92818780 CACTCCCACCTTTCCTCTGCAGG - Intergenic
1132674536 16:1116257-1116279 CACCCCCACATGTCCCTTGTGGG - Intergenic
1134069592 16:11252652-11252674 CACACCCAGCCTTCCGATGTAGG - Intronic
1137839666 16:51628579-51628601 CACTCACACCTATCCTATGAGGG - Intergenic
1138297217 16:55897227-55897249 CATTCCCTGCTGTCCTATGTAGG + Intronic
1144014065 17:11177052-11177074 CACTCCCACCAGTGCCATGACGG - Intergenic
1152579359 17:81159307-81159329 CCCTCCCAGCTGCCCCATGTTGG - Intronic
1153030483 18:709049-709071 CCCTCCCTCCTGACCCATGTTGG - Intronic
1155049322 18:22132796-22132818 CAGGCCCACATGTCAGATGTGGG - Intergenic
1161709836 19:5841693-5841715 CCCAGCCACCTGGCCGATGTTGG - Intergenic
1166767922 19:45263359-45263381 CATTCCCTCCTCACCGATGTTGG - Exonic
1168374206 19:55861816-55861838 CACTGCCAGCTGTCCCTTGTGGG + Intronic
1168561698 19:57389981-57390003 CACTCCCGCCTCTCCGTGGTGGG - Exonic
927240218 2:20914409-20914431 CAGTATCACCTATCCGATGTTGG + Intergenic
928375318 2:30768934-30768956 CACTCCCTCCTGTGCTATTTGGG - Intronic
932216476 2:69969503-69969525 CACTCCCCTCTGTCCTTTGTGGG + Intergenic
946511212 2:220358642-220358664 CTCCCCCACCAGTCCTATGTGGG + Intergenic
1175124023 20:56738384-56738406 CACACCCACTGGTCCAATGTGGG + Intergenic
1179157628 21:38863731-38863753 CACTCCCACCTGGAAGATGGTGG + Intergenic
1182739156 22:32554327-32554349 CACTCCTCCCTGTCCGCTCTGGG + Intronic
1183484084 22:38080146-38080168 CACTCCCACCTTTCCAATTTTGG + Intronic
1184738491 22:46412865-46412887 CACGGCCACCTGTGGGATGTAGG - Intronic
1185300038 22:50074751-50074773 CACACCCACCCGTGCCATGTGGG + Intronic
950967564 3:17156541-17156563 CACTTCCACCAATCCAATGTGGG - Intergenic
953616529 3:44495779-44495801 CACTGCCACCAGTCTGGTGTGGG - Intergenic
957518394 3:81286521-81286543 CACTCCCACCAGTGCCATGAAGG + Intergenic
957736628 3:84211855-84211877 CTCTTCCACCTGTTCAATGTGGG + Intergenic
958406738 3:93762942-93762964 TACTCCCAGCTGTCCCATCTGGG - Intergenic
958895183 3:99821428-99821450 AACTCCCAGCTGTCTTATGTTGG - Intronic
963767198 3:149350088-149350110 CTCTCCCACCTCTCCCATCTTGG - Intergenic
966499860 3:180626840-180626862 AACTACCACCTGTCCAAGGTGGG - Intronic
967104479 3:186244291-186244313 CCCTGCCACCTTTCAGATGTGGG - Intronic
968180416 3:196591183-196591205 GACTCCCACCTTTCAGATATTGG - Intergenic
969348590 4:6584782-6584804 TACTCCCTCCTGTCAGATATTGG - Intronic
969905411 4:10389675-10389697 CTCACCCACCTGTCCAATGCTGG - Intergenic
970601879 4:17647202-17647224 CCCTCCCCCCTGCCCGAAGTGGG - Intronic
974287208 4:59883829-59883851 CAATCTCATCTGTCCAATGTGGG + Intergenic
975590050 4:75990743-75990765 CACTCCCACCTCCTCGATGTAGG + Exonic
975687993 4:76936888-76936910 CACTCTCAATTGTCTGATGTTGG - Intergenic
978424186 4:108565173-108565195 CACTGCCATCTGTCAGTTGTGGG - Intergenic
989107250 5:37875089-37875111 CACTGCCAACAGTCTGATGTGGG - Intergenic
1000041147 5:157486190-157486212 CACTCACAACTGTGCAATGTCGG + Intronic
1002585703 5:180245539-180245561 CCCTCCCACCTGTAGGATGCTGG - Intronic
1006376711 6:33675627-33675649 CACTCCCTGCTGTCCGTGGTGGG - Intronic
1014297549 6:119638518-119638540 CACCCCCACCTGTCCAAGGTTGG - Intergenic
1021218007 7:17940656-17940678 CACTCCCAGCGGTCCCAAGTTGG - Intergenic
1022558358 7:31323931-31323953 CACCCCGACCTGCCCGATCTAGG + Intergenic
1023187866 7:37550177-37550199 CACTCCCACCAGTGCCATGAGGG + Intergenic
1030316933 7:108125675-108125697 CACTCCCACCTGTCCGATGTAGG - Intronic
1030457681 7:109794816-109794838 TACTCCCACCTGGCCTATGATGG + Intergenic
1035333253 7:158110176-158110198 CACACCCAGCTGTGCGCTGTGGG + Intronic
1035625146 8:1066079-1066101 CACTCAGACCTGACCGTTGTGGG - Intergenic
1056167976 9:83956897-83956919 GAGTCCCACCTGTCCGAAGCGGG - Intronic
1056683746 9:88742583-88742605 CACTCCCACCCTTCAGATGTGGG - Intergenic
1057943120 9:99302194-99302216 CACTCCCACCAGTGCCATGATGG + Intergenic
1190797763 X:53760323-53760345 CACCCCCACCTCTCCAATGGGGG - Intergenic
1190917393 X:54820891-54820913 CACCCCCACCTCTCCAATGGGGG + Intergenic
1191979604 X:66911405-66911427 CACTGCCCCCTGTCCAAGGTAGG - Intergenic