ID: 1030318497

View in Genome Browser
Species Human (GRCh38)
Location 7:108140667-108140689
Sequence CTGTGTGAAGAAAAGAAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030318492_1030318497 3 Left 1030318492 7:108140641-108140663 CCTCTGGGTGGGAAAGGCCACAG No data
Right 1030318497 7:108140667-108140689 CTGTGTGAAGAAAAGAAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030318497 Original CRISPR CTGTGTGAAGAAAAGAAAGG GGG Intergenic
No off target data available for this crispr