ID: 1030319937

View in Genome Browser
Species Human (GRCh38)
Location 7:108155561-108155583
Sequence GGTACCAAGGGAACAGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 212}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030319937_1030319941 15 Left 1030319937 7:108155561-108155583 CCTGCTTCTGTTCCCTTGGTACC 0: 1
1: 0
2: 0
3: 22
4: 212
Right 1030319941 7:108155599-108155621 TCATAGCACTTTTCACACTCTGG 0: 1
1: 0
2: 3
3: 21
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030319937 Original CRISPR GGTACCAAGGGAACAGAAGC AGG (reversed) Intronic
900229898 1:1551359-1551381 GCTGCAAAGGGAACAGCAGCAGG + Intronic
901519051 1:9768867-9768889 GGCACCAAAGCAACAGAAGAGGG + Intronic
901713308 1:11133065-11133087 GGTACAAGGTGATCAGAAGCAGG - Exonic
902204769 1:14860075-14860097 GGTACCATTGCAACAGTAGCAGG + Intronic
902730366 1:18365024-18365046 GGTACAATGGGAACACATGCAGG - Intronic
904177651 1:28642495-28642517 GTTTGGAAGGGAACAGAAGCGGG - Intronic
905559663 1:38916444-38916466 GGTACCAGAGGAACAGAAAGAGG + Intronic
905776850 1:40673481-40673503 GGGACCGAGGGTACAGAAGTAGG + Intergenic
906561052 1:46757240-46757262 GGCACCAAGGGACCAGAAGGCGG + Intergenic
906673108 1:47673680-47673702 GAAACCAAGGAAACAAAAGCTGG - Intergenic
906898200 1:49802711-49802733 GGCACCACGGGACCAGAAGGCGG + Intronic
907941116 1:59088309-59088331 GAATCCAAGGGAACAGAAGTAGG - Intergenic
909751971 1:79172616-79172638 GGTGCCAAAGGAACAAAAGCAGG - Intergenic
910117012 1:83742625-83742647 GGCAGTAAGGGAACAGAAGCTGG + Intergenic
910502092 1:87904028-87904050 AGTACAAAGGGCCCAGAAGCTGG - Intergenic
910514633 1:88046480-88046502 TATACCAAGAGATCAGAAGCTGG - Intergenic
910831612 1:91467137-91467159 GGCACCATGGGACCAGAAGGCGG + Intergenic
911086133 1:93978889-93978911 TCTGCCAAGGTAACAGAAGCTGG - Intergenic
914418894 1:147510249-147510271 GGTGCCTGGGGAAAAGAAGCCGG + Intergenic
914814912 1:151056213-151056235 GGTACCAAGGGAGAGGAAGGGGG + Intronic
914985116 1:152449844-152449866 AGGACCCAGGGAACAGAAGGGGG - Intergenic
917014145 1:170510867-170510889 GAACCCAAGGGAACAGAAGATGG - Intergenic
917485692 1:175452612-175452634 GGGACAAAGGTGACAGAAGCTGG + Intronic
919777269 1:201202445-201202467 GGGACAAGGGGAAGAGAAGCAGG - Intronic
921975345 1:221196689-221196711 GGCACCATGGGACCAGAAGGCGG - Intergenic
1062940891 10:1420729-1420751 TGCACCCAGGGCACAGAAGCAGG + Intronic
1063249291 10:4256115-4256137 CCTACCAAGGGAATAGGAGCTGG - Intergenic
1063252880 10:4293449-4293471 GGTAACCAGGGAAAAGAAGCAGG - Intergenic
1064261598 10:13790702-13790724 GGTACGATGGCACCAGAAGCTGG + Intronic
1067294817 10:44969491-44969513 GGTACTAAGAGACCAGAATCAGG + Intronic
1067720357 10:48723382-48723404 GGCAGCAAGGCAGCAGAAGCAGG - Intronic
1067960947 10:50848784-50848806 GGACCCAAGGGAACAGGAGCAGG - Intronic
1072386828 10:94939285-94939307 GGCACCATGGGACCAGAAGGCGG - Intronic
1072512126 10:96138314-96138336 AGTAACAAGGGGACAGAAACAGG - Intronic
1072549108 10:96463690-96463712 GGTCCCAAGGGAGCTGGAGCTGG - Intronic
1073279486 10:102342476-102342498 GGTAGTAGGGGAAGAGAAGCAGG + Intronic
1076465781 10:130680817-130680839 ATTACCATGGGAACAGAAACAGG + Intergenic
1077117798 11:893189-893211 GGGGCCAAGTGGACAGAAGCAGG - Intronic
1077416315 11:2425890-2425912 GGGACGAAGGGAAGAGAAGAAGG - Intergenic
1077539219 11:3138781-3138803 GGGACCAAGGGAGAAGCAGCTGG + Intronic
1079564279 11:21862519-21862541 GTTCCCAAGGGAACAGTAGAAGG - Intergenic
1080055516 11:27902545-27902567 GGTGACAAAGGAACAGATGCAGG - Intergenic
1083888141 11:65582626-65582648 GGGACCCAGAAAACAGAAGCTGG + Exonic
1084714357 11:70864188-70864210 GTTGCCACGGCAACAGAAGCTGG - Intronic
1085455530 11:76663408-76663430 GGTAGGGAGGGAACACAAGCCGG + Intronic
1085880750 11:80463908-80463930 GGTTCCGAGGGAAGAGTAGCTGG - Intergenic
1086362319 11:86071440-86071462 GGAACTAAGGCAACAGAAGTGGG - Intergenic
1087579352 11:100031918-100031940 GGCACCACGGGACCAGAAGGTGG + Intronic
1088148945 11:106720614-106720636 GTTATCAAGGGAACAGAACAAGG + Intronic
1088801733 11:113313156-113313178 GTTACCAATGGAAAAAAAGCAGG - Intergenic
1091096452 11:132826929-132826951 GGTATAAAGGGAAGAGAAGGGGG + Intronic
1092621904 12:10281190-10281212 GCAATCATGGGAACAGAAGCTGG + Intergenic
1098291271 12:68958819-68958841 GTTACCAAGGGATGAGAGGCAGG - Intronic
1099810702 12:87578926-87578948 GGCACCATGGGACCAGAAGGTGG - Intergenic
1100325647 12:93537593-93537615 GCTACCCAGGGGACTGAAGCAGG - Intergenic
1103199895 12:119079213-119079235 GGAACCAAGGATACAGAAGGAGG + Intronic
1103376796 12:120462815-120462837 GATGCCAAGGGGAAAGAAGCCGG + Exonic
1103627201 12:122228472-122228494 GGTTAAAAGGGAACAGAATCAGG - Intronic
1104089121 12:125500050-125500072 GGCACCATGGGACCAGAAGGCGG + Intronic
1111755204 13:92384702-92384724 GGTACCAAATGAATAGCAGCAGG + Intronic
1113783768 13:112991204-112991226 TGTACAAAGTTAACAGAAGCAGG - Intronic
1114407982 14:22474183-22474205 TTTACCAAGGGAGCAGAAGCAGG + Intergenic
1117337381 14:54766906-54766928 GGTACCAAGGGAGGACATGCAGG - Intronic
1120534679 14:85679785-85679807 GTTATCTAGGGAACAGAAACTGG + Intergenic
1121758359 14:96422042-96422064 GGCACCACGGGACCAGAAGGCGG - Intronic
1122188706 14:100022685-100022707 GGTGCCAAGGAAACAAAAACAGG - Intronic
1122473329 14:101987226-101987248 GGGAGTAAGGGAAGAGAAGCTGG + Intronic
1123208142 14:106733577-106733599 GGCACCATGGGACCAGAAGGCGG + Intergenic
1124803258 15:32856045-32856067 TGCACCAAGGGAACAGCAGCTGG + Intronic
1126798652 15:52280975-52280997 GGTAACAGGGGAGCAGGAGCTGG - Intronic
1126826726 15:52558810-52558832 GGTACAAAGGGAAGGGAAACAGG - Intronic
1128555423 15:68628527-68628549 TGTAACAAGGGAATAGAAACAGG + Intronic
1129251577 15:74312163-74312185 GGAACAAGGGGAACATAAGCTGG - Intronic
1129797251 15:78387196-78387218 GGTATCAAGGGGAGACAAGCTGG + Intergenic
1130541872 15:84826399-84826421 GGGGCAAAGGGAAGAGAAGCAGG - Intronic
1131173170 15:90192478-90192500 AGTACAAAGGGAACAGATGCAGG - Intronic
1134098506 16:11435546-11435568 GGTCTCAGGGGAACAGAAGAGGG + Intronic
1141182823 16:81765937-81765959 GGGACCCAGGTAACAGATGCAGG + Intronic
1143850861 17:9810871-9810893 GGAACCAAGGGAAAAGACACTGG - Intronic
1144297274 17:13888022-13888044 GGTACAAAAGGAACAAAAGAAGG - Intergenic
1145089986 17:19978123-19978145 GGTACCCAGGGGCCGGAAGCCGG - Intronic
1147469673 17:40647800-40647822 GGGACAAAGGGAAGCGAAGCCGG - Exonic
1148484392 17:47981404-47981426 GATACCAAGTGGGCAGAAGCAGG - Intronic
1148836046 17:50466488-50466510 GGTGCCAGGGGAAGAGGAGCTGG - Intronic
1150859944 17:68790925-68790947 GGTAACAAGGGATGAGAAACTGG + Intergenic
1152000648 17:77643230-77643252 GGTACCCAGGGAAGAGAAGAGGG - Intergenic
1152208069 17:78986826-78986848 GGTTGCAAGAGAAGAGAAGCAGG + Intergenic
1153344351 18:4009830-4009852 CGGACCAAGGGAACAGTAGCAGG + Intronic
1153583989 18:6602616-6602638 GGTACCAGCAGAAGAGAAGCCGG + Intergenic
1155533049 18:26786951-26786973 GCTACCCACTGAACAGAAGCAGG - Intergenic
1156599268 18:38585264-38585286 GGTACCAAGGACACAGACACTGG - Intergenic
1156835984 18:41555617-41555639 GATCCCATGGGAACAGCAGCCGG + Intergenic
1158215218 18:55093933-55093955 GGTACCAAGTGAAAAGAAAAAGG + Intergenic
1159118775 18:64145423-64145445 GGCACCATGGGACCAGAAGGCGG + Intergenic
1162003507 19:7763281-7763303 GGAACCAAGGGTGCAGCAGCTGG + Exonic
1166863645 19:45823532-45823554 GGCACCCAGGAAAGAGAAGCAGG + Intronic
926777435 2:16436545-16436567 TATACCAAGGGAAGAGAAGATGG - Intergenic
926897478 2:17710109-17710131 GGTGCCAAGTAACCAGAAGCAGG + Intronic
927853798 2:26515761-26515783 GAGACCAAGGGGACAGAATCTGG - Intronic
928910717 2:36418085-36418107 GGGACTAAGGGAACAGGTGCAGG + Intronic
929005573 2:37389984-37390006 GGCACCGAGGGAACAGATGCAGG + Intergenic
930304910 2:49665661-49665683 GGTTCCCAGGGAAGAGAGGCTGG + Intergenic
931794418 2:65695703-65695725 GTTACCAAGAGAAGAGAAGGGGG + Intergenic
937187129 2:120054830-120054852 TGTATCAATGGAACAGAAGAGGG - Intronic
938001434 2:127742413-127742435 GCTACCAAGGAAACAGAGGTGGG + Intronic
938741322 2:134235216-134235238 GGTACTGAGGGAAGAGAAACAGG - Intronic
938814216 2:134883233-134883255 GATACCAAGGGAATAGGATCTGG + Intronic
940927548 2:159381839-159381861 ATGACCAAGGGCACAGAAGCAGG - Intronic
941494923 2:166188064-166188086 GGTCCCAAGGAGACAGAAGCAGG + Intergenic
941894817 2:170618654-170618676 GGCACCATGGGACCAGAAGGCGG - Intronic
942498754 2:176566046-176566068 GGCAACAAGGGAAGGGAAGCAGG + Intergenic
943767343 2:191677630-191677652 GGTACCAAGGGAAAACAGGCTGG - Intergenic
947534584 2:230932935-230932957 AATCCTAAGGGAACAGAAGCCGG + Intronic
1169564545 20:6839543-6839565 GGGGCTAAGGGAACAGAAGAGGG - Intergenic
1174320143 20:49735286-49735308 GGTACGTGGGGGACAGAAGCAGG - Intergenic
1174719594 20:52797795-52797817 AGAACCAATGGAACAGAAACAGG - Intergenic
1177357256 21:20024901-20024923 GTTACCATGGTAACAGAAGTCGG + Intergenic
1179433497 21:41343166-41343188 TGAGCCAAGGGAACAGAAGTTGG - Intronic
1182377092 22:29856586-29856608 GGTACAAGGGGAACAGGAGTAGG - Intergenic
1183058953 22:35323651-35323673 GGAACCAAGGGAAGGGAGGCAGG + Intronic
1183671568 22:39276003-39276025 GCTATCAAGGGAGCAGAGGCGGG - Intergenic
1185166865 22:49266784-49266806 AGCACCAGGGGAACAGAAGGAGG + Intergenic
949370916 3:3333892-3333914 GGATCCAAGGGAACCAAAGCTGG + Intergenic
950500485 3:13360460-13360482 GTTACCAAGGCAACAGAGGAGGG + Exonic
950662679 3:14476461-14476483 GCTCCCAAAGGAAAAGAAGCTGG - Intronic
953497695 3:43402634-43402656 AGGACCAAGGGCACAGAAGAAGG - Intronic
954708551 3:52493878-52493900 GGAAACGGGGGAACAGAAGCAGG - Intergenic
956608755 3:71100506-71100528 GATACCAATGGAAAAGAAGCAGG + Intronic
958442744 3:94176199-94176221 GGTAGCAAGTGAATAGAATCTGG + Intergenic
961354833 3:126330979-126331001 GGTACCCAGGCAGCAGAAGCTGG + Intergenic
962253496 3:133854136-133854158 GGTTCCTAGGGCAAAGAAGCTGG - Intronic
965077759 3:164001695-164001717 GTTGCCAAGTGATCAGAAGCTGG - Intergenic
965395974 3:168160798-168160820 GGTCCCAAGGGAGCAGATGAGGG + Intergenic
966124235 3:176556788-176556810 GCTCCCAAGGGAACAGGAGGTGG - Intergenic
967032293 3:185619270-185619292 AATACCAAGGGAGCAAAAGCTGG - Intronic
967590446 3:191267585-191267607 GGCACCATGGGACCAGAAGGTGG - Exonic
969234942 4:5859145-5859167 TGTACCAGGTGAACAAAAGCAGG - Intronic
970114219 4:12675419-12675441 GATACTAAGTGAACAAAAGCAGG + Intergenic
970697127 4:18691483-18691505 GGAACCCAGGGCTCAGAAGCCGG + Intergenic
971425853 4:26514703-26514725 GGGAACCAGGGAACAGAGGCAGG + Intergenic
972964237 4:44489620-44489642 GCTACCAAGGAATCTGAAGCAGG - Intergenic
975170134 4:71223845-71223867 GTTCGGAAGGGAACAGAAGCGGG - Intronic
977058080 4:92218480-92218502 GGCACCACGGGACCAGAAGACGG + Intergenic
977920884 4:102641279-102641301 GGGAGCAATGGAAGAGAAGCTGG + Intronic
978315091 4:107426998-107427020 GGTATCATGGAAACAGAAACAGG - Intergenic
979547533 4:121954528-121954550 GGTAGCAAGAGCACAGAAACAGG + Intergenic
980661435 4:135864078-135864100 GGCACCATGGGACCAGAAGGCGG - Intergenic
981658579 4:147140451-147140473 GGTAGAAAGTGAACAGGAGCAGG + Intergenic
982764672 4:159331792-159331814 GGTAGCAAAGCAACTGAAGCAGG + Exonic
983472072 4:168169488-168169510 GGGAGGGAGGGAACAGAAGCAGG - Intronic
984225420 4:177029079-177029101 AGTACCATGGGAACAGGAACCGG - Intergenic
986129233 5:4911696-4911718 GGCTCCAAGGGAACAGAATCAGG - Intergenic
986164241 5:5259626-5259648 GGTTGCAAGGGAAAAGGAGCAGG + Intronic
987083292 5:14445769-14445791 TGGCCCAAGGGCACAGAAGCAGG + Intronic
988519073 5:31930038-31930060 GGCAAAAAGGGAGCAGAAGCAGG - Intronic
988916271 5:35896516-35896538 GGTCACAAGGGAACTGTAGCTGG - Intergenic
990324289 5:54659786-54659808 GGCACCAATGGAGCTGAAGCAGG + Intergenic
991515919 5:67435261-67435283 GGTCCCAAGTGAACTGAAACTGG + Intergenic
992818692 5:80471578-80471600 GGCACCACGGGACCAGAAGGCGG + Intronic
995820094 5:116220201-116220223 GGTACCTAGGGAGCAAAATCAGG + Intronic
997949481 5:138230747-138230769 AGGACTAAGGTAACAGAAGCGGG + Intergenic
1001101784 5:168820265-168820287 GGTGCCAGGTGAACAGAAGAAGG - Intronic
1001944948 5:175770983-175771005 GGTCTCAAGGGACCAGAAGAAGG - Intergenic
1004099950 6:12599210-12599232 GCTACCCTGGGAACAGCAGCAGG + Intergenic
1004650624 6:17604027-17604049 GGTAGGAAAGGAACAGAACCAGG - Intronic
1004945070 6:20603455-20603477 GGAAGCAATGGAACAGAAGTTGG - Intronic
1005440985 6:25868493-25868515 GGCACCAAGGAAAAAAAAGCTGG + Intronic
1006501460 6:34461788-34461810 GGTACCATGGAAACTGAGGCTGG + Intergenic
1006692586 6:35902299-35902321 GCTACTAAGGGAGCAGAGGCAGG + Intronic
1007147197 6:39647821-39647843 GCTACCCAGGGAACTGAGGCAGG - Intronic
1007412671 6:41673972-41673994 GGCCCCCAGGGAACAGGAGCAGG + Intergenic
1007903435 6:45434244-45434266 GGTACAAAGGGTACAAAGGCAGG - Intronic
1009312252 6:62169922-62169944 GGGACCACTGGGACAGAAGCTGG - Intronic
1009403866 6:63289101-63289123 AGTACCAAGAAAACAGCAGCAGG - Intronic
1010054623 6:71551057-71551079 GCTGCCAAGTGATCAGAAGCTGG - Intergenic
1010753086 6:79636377-79636399 GGTACCCAGTGAACAGAAACAGG + Intronic
1012209516 6:96502481-96502503 GGTGCCAAGGGAACAAAAATTGG + Intergenic
1016289019 6:142507149-142507171 GATTCCAAGGGAAGAGAGGCTGG + Intergenic
1019688153 7:2393948-2393970 GTTGCCAAGTGAGCAGAAGCTGG - Intergenic
1021852036 7:24817739-24817761 GGAACCAAGACAACAGACGCGGG + Intronic
1021992276 7:26150872-26150894 GGGACCAGGGGAGCAGAAACAGG - Intergenic
1022450471 7:30509158-30509180 GGCACCACGGGACCAGAAGATGG - Intronic
1022467288 7:30660518-30660540 GGTGCCAAGAGGACAGAAGAGGG - Intronic
1023278852 7:38548922-38548944 GGTAACAAAGAAACAGAAGATGG + Intronic
1025825383 7:65006599-65006621 GGTAACGAGGCCACAGAAGCTGG + Exonic
1028024032 7:85814032-85814054 GGTGCCAAGGAAATATAAGCAGG - Intergenic
1028628805 7:92909781-92909803 GGTACCAAGGAAACAAAAATTGG - Intergenic
1028748628 7:94356493-94356515 GGAACCAAGGGAAATGAAGCAGG + Intergenic
1028895013 7:96031286-96031308 GGTACCCAAGGAACAGATGAAGG + Intronic
1029407297 7:100383199-100383221 GGTACCCTGGGACCAGCAGCAGG + Intronic
1030319937 7:108155561-108155583 GGTACCAAGGGAACAGAAGCAGG - Intronic
1031974142 7:128083268-128083290 TGCTCCAAGGCAACAGAAGCAGG - Intronic
1032974452 7:137206314-137206336 GGCACCATGGGACCAGAAGGCGG + Intergenic
1033662366 7:143410902-143410924 GGTACAAAGCCAACAGAAGGGGG + Intergenic
1033863252 7:145656113-145656135 AGTCCCAAAGGAACAGAGGCAGG - Intergenic
1035576366 8:709329-709351 GTCACCGAGGGAACCGAAGCAGG + Intronic
1039413609 8:37375554-37375576 AGAACAAAGGGAACAGATGCAGG + Intergenic
1040974710 8:53177341-53177363 GTAACCAAGGGAACAGATGTGGG - Intergenic
1041296357 8:56361295-56361317 GGCACCTTGGGACCAGAAGCTGG + Intergenic
1045245043 8:100435394-100435416 GGTACCAAGGGGCCAGAGGATGG + Intergenic
1045582617 8:103498527-103498549 GGTACCTGGGGAACAGAGGGAGG + Intergenic
1046127936 8:109933944-109933966 GGTAGCAAAGGAAGAAAAGCTGG - Intergenic
1047559539 8:125971799-125971821 AGTACCAAAGGACCAAAAGCTGG + Intergenic
1048193047 8:132307939-132307961 GGTCCAAAAGGAAAAGAAGCTGG - Intronic
1048431939 8:134378627-134378649 GGCACCATGGGACCAGAAGGCGG - Intergenic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1049090441 8:140510529-140510551 AGTACCAAGGGGACAGCAGCTGG - Intergenic
1050096611 9:2073861-2073883 GAAACCAAGAGAAGAGAAGCTGG + Intronic
1050423739 9:5493074-5493096 GACACCAAGGGCAGAGAAGCTGG - Intergenic
1053027050 9:34738786-34738808 GGAAGCAAGGGAGCATAAGCTGG - Intergenic
1053453005 9:38209067-38209089 GGCACCAAGAGAAAAGTAGCAGG - Intergenic
1056204913 9:84310458-84310480 GTAACCAATGGTACAGAAGCTGG + Intronic
1056805563 9:89726202-89726224 GGTTGCAAGGGAACAGACACTGG - Intergenic
1060345195 9:122809799-122809821 GGCACCACGGGACCAGAAGGCGG + Intronic
1061260006 9:129474996-129475018 GGTGCTCAGGGAACAGGAGCTGG - Intergenic
1062185587 9:135216501-135216523 GGCCCCAAGGGAAGGGAAGCTGG - Intergenic
1062228540 9:135467649-135467671 TTTATCAAGGGCACAGAAGCTGG + Intergenic
1187153320 X:16701445-16701467 GCTACCCAGGGGACTGAAGCAGG + Intronic
1187245296 X:17548422-17548444 GATCCCCAGGGAACAGAGGCTGG + Intronic
1187729362 X:22237126-22237148 GGTACTAAGAAAACAGTAGCAGG + Intronic
1188522401 X:31053414-31053436 GTTACCAAGGGAAATGAAGCAGG + Intergenic
1191223635 X:58017007-58017029 GGTTCCCAGGGAATAGGAGCTGG - Intergenic
1191685421 X:63884857-63884879 GGCTGCAAGGGAACAGAAACAGG + Intergenic
1192253266 X:69431827-69431849 TCTACCAAGGGAACACAAGTGGG - Intergenic
1193456667 X:81739528-81739550 TGTACCAATGGAACAGAATCAGG - Intergenic
1193565497 X:83071155-83071177 GGCACCACGGGACCAGAAGGCGG + Intergenic
1193984107 X:88219478-88219500 GGTCCAAATGGAACAGCAGCCGG - Intergenic
1194192508 X:90855215-90855237 GGCACCACGGGACCAGAAGGTGG + Intergenic
1194419585 X:93657157-93657179 TGTAAGAAGGGAAAAGAAGCTGG - Intergenic
1196535691 X:116841131-116841153 TGTACTAAGTGAAGAGAAGCTGG - Intergenic
1196828374 X:119758397-119758419 GGTACCCAGGGAAGTGGAGCTGG + Intergenic
1197040071 X:121926359-121926381 CATACCAAGTGAACAAAAGCTGG + Intergenic
1200539140 Y:4437659-4437681 GGCACCACGGGACCAGAAGGTGG + Intergenic
1201622290 Y:15973467-15973489 GGCACCATGGGACCAGAAGGCGG - Intergenic
1202097552 Y:21267492-21267514 GGTAACAAGGGAAGAGACTCTGG - Intergenic