ID: 1030322280

View in Genome Browser
Species Human (GRCh38)
Location 7:108181870-108181892
Sequence GTACCTTAGCCGAGGTGCAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 40}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030322280_1030322285 21 Left 1030322280 7:108181870-108181892 CCAGTGCACCTCGGCTAAGGTAC 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1030322285 7:108181914-108181936 CGTTCCCAGGAGCCACCATTGGG 0: 1
1: 0
2: 0
3: 19
4: 85
1030322280_1030322284 20 Left 1030322280 7:108181870-108181892 CCAGTGCACCTCGGCTAAGGTAC 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1030322284 7:108181913-108181935 ACGTTCCCAGGAGCCACCATTGG 0: 1
1: 0
2: 0
3: 12
4: 98
1030322280_1030322283 8 Left 1030322280 7:108181870-108181892 CCAGTGCACCTCGGCTAAGGTAC 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1030322283 7:108181901-108181923 ACATTCACACGCACGTTCCCAGG 0: 1
1: 0
2: 2
3: 5
4: 107
1030322280_1030322288 27 Left 1030322280 7:108181870-108181892 CCAGTGCACCTCGGCTAAGGTAC 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1030322288 7:108181920-108181942 CAGGAGCCACCATTGGGACTAGG 0: 1
1: 0
2: 0
3: 19
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030322280 Original CRISPR GTACCTTAGCCGAGGTGCAC TGG (reversed) Exonic
907718940 1:56953717-56953739 GTGCCTTGCCCGAGGTGCCCTGG + Intronic
911988105 1:104657404-104657426 ATTCCTTAACCCAGGTGCACAGG - Intergenic
917953231 1:180063487-180063509 GTACCTTAGAATAGGTCCACTGG - Intronic
1075462114 10:122623767-122623789 GTATCTTAGCCCAGGCTCACAGG + Intronic
1078519126 11:12049395-12049417 GCAGCTTGGCCGAGGTGCTCAGG + Intergenic
1090662455 11:128891651-128891673 GTCCCTTAGCGGCGGTGCAGGGG - Exonic
1098861692 12:75717840-75717862 GTACCTTAGCTGAGGTGGAATGG + Intergenic
1113368652 13:109702429-109702451 GTCCCTTAGCCGAGGCACACTGG - Intergenic
1130114214 15:80992272-80992294 GAATCTAAGCCGAGGTGTACTGG + Intergenic
1135840280 16:25869924-25869946 GTAACTTGGCCAAGATGCACAGG + Intronic
1145797229 17:27662760-27662782 GTCCCTTAGCTGAGGTCCAAAGG + Intergenic
1145811630 17:27767701-27767723 GTACCTTTGCTGAGGTCCAAAGG + Exonic
1146841976 17:36162541-36162563 GTCCCTTAGCTGAGGTCCAAAGG + Intergenic
1146854287 17:36250501-36250523 GTCCCTTAGCTGAGGTCCAAAGG + Intronic
1146870190 17:36374393-36374415 GTCCCTTAGCTGAGGTCCAAAGG + Intronic
1146877547 17:36425474-36425496 GTCCCTTAGCTGAGGTCCAAAGG + Intronic
1147073071 17:37975017-37975039 GTCCCTTAGCTGAGGTCCAAAGG + Intergenic
1147084593 17:38054555-38054577 GTCCCTTAGCTGAGGTCCAAAGG + Intronic
1147100540 17:38178521-38178543 GTCCCTTAGCTGAGGTCCAAAGG + Intergenic
1147211958 17:38877097-38877119 GAACCTTAGCCGAGGGGGTCAGG - Intronic
1150083479 17:62261567-62261589 GTCCCTTAGCTGAGGTCCAAAGG + Intergenic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1167819551 19:51914320-51914342 GTACTTTAGGTGAGGTGCAGTGG - Intronic
926629881 2:15126550-15126572 GTACCTCACCCGAGGGGCAAGGG + Intergenic
932771143 2:74501576-74501598 GTACCTGAGCCCAGCTGCAGAGG - Intronic
938393291 2:130921977-130921999 GTTCCTTAGGCCAGGTGCAGTGG - Intronic
954866741 3:53736051-53736073 GAACATTAGGCCAGGTGCACTGG + Intronic
954894304 3:53962997-53963019 GTACCTTAGCTGAATTCCACTGG - Intergenic
956618764 3:71199393-71199415 GTACCTTAGGCCAGGTGCCATGG - Intronic
962154988 3:132936775-132936797 ATACCTTAGGCTAGGTGCAGTGG - Intergenic
968588879 4:1447827-1447849 GTACCAAAGCCAAGGTGGACTGG + Intergenic
984316908 4:178140457-178140479 GTGCCTTAGCCAAGGTCCAATGG + Intergenic
991449887 5:66740721-66740743 GTACCTGATCCAAGTTGCACAGG - Intronic
998142993 5:139710193-139710215 GCACCTCAGCCTAGGCGCACAGG - Intergenic
1008683294 6:53897167-53897189 GTACCTTAGCAGATGTTCACTGG - Intronic
1013545510 6:111153208-111153230 GTTCCCTAGCTTAGGTGCACTGG + Intronic
1016186350 6:141202339-141202361 CTACCTTAGCCTTGATGCACAGG + Intergenic
1030322280 7:108181870-108181892 GTACCTTAGCCGAGGTGCACTGG - Exonic
1032258694 7:130317170-130317192 GTACAATAGGCCAGGTGCACTGG - Intronic
1045713135 8:105010109-105010131 GTATCTTAGTCCAGGTCCACTGG + Intronic
1049723101 8:144130330-144130352 GTACCTTTGGCCAGGTGCAGTGG + Intergenic
1053422435 9:37987953-37987975 GTACCTCAGCCCAGGTGACCAGG - Intronic
1056302612 9:85257883-85257905 GTGGCTTTGCCGAGCTGCACTGG + Intergenic
1059886430 9:118749538-118749560 GTCCCTGAGCCCAGATGCACAGG + Intergenic