ID: 1030323231

View in Genome Browser
Species Human (GRCh38)
Location 7:108192091-108192113
Sequence TTTGGGGACCCGTGCTCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 1, 2: 19, 3: 101, 4: 367}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030323231_1030323244 18 Left 1030323231 7:108192091-108192113 CCTCTAGAGCACGGGTCCCCAAA 0: 1
1: 1
2: 19
3: 101
4: 367
Right 1030323244 7:108192132-108192154 GTACTGTCCTGTTAGGAACTGGG 0: 1
1: 1
2: 6
3: 45
4: 279
1030323231_1030323248 29 Left 1030323231 7:108192091-108192113 CCTCTAGAGCACGGGTCCCCAAA 0: 1
1: 1
2: 19
3: 101
4: 367
Right 1030323248 7:108192143-108192165 TTAGGAACTGGGCTGCAGAGGGG No data
1030323231_1030323246 27 Left 1030323231 7:108192091-108192113 CCTCTAGAGCACGGGTCCCCAAA 0: 1
1: 1
2: 19
3: 101
4: 367
Right 1030323246 7:108192141-108192163 TGTTAGGAACTGGGCTGCAGAGG No data
1030323231_1030323242 11 Left 1030323231 7:108192091-108192113 CCTCTAGAGCACGGGTCCCCAAA 0: 1
1: 1
2: 19
3: 101
4: 367
Right 1030323242 7:108192125-108192147 GAACTGGGTACTGTCCTGTTAGG 0: 1
1: 0
2: 1
3: 9
4: 118
1030323231_1030323243 17 Left 1030323231 7:108192091-108192113 CCTCTAGAGCACGGGTCCCCAAA 0: 1
1: 1
2: 19
3: 101
4: 367
Right 1030323243 7:108192131-108192153 GGTACTGTCCTGTTAGGAACTGG 0: 1
1: 1
2: 5
3: 41
4: 301
1030323231_1030323247 28 Left 1030323231 7:108192091-108192113 CCTCTAGAGCACGGGTCCCCAAA 0: 1
1: 1
2: 19
3: 101
4: 367
Right 1030323247 7:108192142-108192164 GTTAGGAACTGGGCTGCAGAGGG 0: 1
1: 1
2: 3
3: 38
4: 198
1030323231_1030323237 -5 Left 1030323231 7:108192091-108192113 CCTCTAGAGCACGGGTCCCCAAA 0: 1
1: 1
2: 19
3: 101
4: 367
Right 1030323237 7:108192109-108192131 CCAAACCCTGGGCCAAGAACTGG No data
1030323231_1030323238 -4 Left 1030323231 7:108192091-108192113 CCTCTAGAGCACGGGTCCCCAAA 0: 1
1: 1
2: 19
3: 101
4: 367
Right 1030323238 7:108192110-108192132 CAAACCCTGGGCCAAGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030323231 Original CRISPR TTTGGGGACCCGTGCTCTAG AGG (reversed) Intronic
901581478 1:10247765-10247787 GTTGGGGACCACTGCTGTAGAGG - Intronic
902104242 1:14020307-14020329 TTTGGGGACCCCTGCTCTATAGG + Intergenic
902570836 1:17346193-17346215 TTGGGGGACCCGGGCTCCTGGGG + Intronic
903043445 1:20549306-20549328 GTTGGGGACCGCTGCTCTATAGG + Intergenic
903619993 1:24691091-24691113 GTTGGGGACTGCTGCTCTAGAGG + Intergenic
904353110 1:29921819-29921841 TTTGGGGGCCCCTGCACTAAAGG + Intergenic
905082930 1:35340836-35340858 TTTGGGTACCCCTGCTATAAAGG + Intronic
905784570 1:40743998-40744020 GTTGGGGACCCCTGCTCTAGTGG - Intronic
907344540 1:53764036-53764058 TTTGAGAACCAGTGTTCTAGTGG - Intergenic
907481157 1:54746385-54746407 GTTGGGGACCGCTGCTCTATAGG + Intergenic
908328656 1:63048792-63048814 GTTGGGGACCCCTGCTCTATAGG + Intergenic
909020073 1:70420626-70420648 GTTGGGGACCCCTGCTTTAAAGG + Intronic
909330690 1:74406422-74406444 ATTGGGCACCCCTGCTCTAGAGG + Intronic
909447786 1:75766906-75766928 GTTGGGGACCCCTGCCCTATAGG - Intronic
910322857 1:85968298-85968320 GTTGGGGACCCCTGCTATATTGG + Intronic
910542850 1:88380719-88380741 TTTGGGGACCACTGGTCTAGTGG - Intergenic
912063947 1:105712223-105712245 GTTGGGGACCCCTGGTTTAGAGG - Intergenic
912869248 1:113288894-113288916 TTTGCAGATCCCTGCTCTAGTGG - Intergenic
914960719 1:152204106-152204128 GTTGGGGACCCCTGCTGTAAGGG + Intergenic
915912417 1:159923237-159923259 TTTGGGGTCCCCAGCTCTGGGGG - Intronic
916406011 1:164498879-164498901 CTTGGGTGCCCCTGCTCTAGAGG + Intergenic
916479535 1:165202461-165202483 TTTGGGGCCCCTTGTTTTAGAGG - Exonic
917348128 1:174049929-174049951 GTTGGGGACCCCTGGTCTAGTGG - Intergenic
921589865 1:216990915-216990937 GTTGGGGACCCCTGCTTTATAGG - Intronic
922029268 1:221782198-221782220 TTTGGGGACACCTTCTCTGGTGG + Intergenic
922085016 1:222338186-222338208 GTTGGGGACCCCTGCTCTAGAGG + Intergenic
922607899 1:226902365-226902387 GTTGGGGACCCCTGATTTAGAGG + Intronic
922865307 1:228855743-228855765 GTTGGGGACCCCTGATCTACAGG - Intergenic
923116747 1:230947453-230947475 ATTGGACACCCCTGCTCTAGAGG - Intronic
923534629 1:234839700-234839722 TTTGGGGACCCCTGAGATAGGGG - Intergenic
1064178459 10:13095691-13095713 TTTGGGGACCCCTGCTTTATTGG + Intronic
1065307351 10:24381675-24381697 ATTAGGGACCAGTGCTCTATAGG + Intronic
1065408830 10:25398884-25398906 GTTGGGGACCCCTGCTTTACTGG - Intronic
1065697272 10:28391330-28391352 GTTGGGGACCCGTGACCTAGGGG - Intergenic
1067199626 10:44156037-44156059 CCTGGGGACCCCTGCTCTACTGG + Intergenic
1068479603 10:57573496-57573518 TTTGACAACCCTTGCTCTAGAGG - Intergenic
1068602462 10:58970087-58970109 ACTGGGGACCGCTGCTCTAGAGG - Intergenic
1070842685 10:79498546-79498568 TGTGGGGACCCCTGCTGTAAAGG - Intergenic
1070874000 10:79784252-79784274 TTTGTGGAGCTGTGTTCTAGTGG - Intergenic
1071640932 10:87306391-87306413 TTTGTGGAGCTGTGTTCTAGTGG - Intergenic
1071654304 10:87431545-87431567 TTTGTGGAGCTGTGTTCTAGTGG + Intergenic
1072256931 10:93629934-93629956 ATTGGGGACCCCTGATCTAAGGG + Intronic
1072812997 10:98478058-98478080 GTTGGGGACCACTGCCCTAGAGG + Intronic
1073875613 10:107918389-107918411 GTTGGGGGCCCGTGCTTTAAAGG + Intergenic
1073914447 10:108386133-108386155 GTTGGGAACCCATGATCTAGAGG - Intergenic
1074318793 10:112382010-112382032 TTTTGAGACCAGTGCTCTATGGG - Intronic
1075236466 10:120735434-120735456 GTTGGGGACCCCTGATCTATAGG - Intergenic
1075917625 10:126182868-126182890 GTTTGGGACCCCTGTTCTAGTGG - Intronic
1076057391 10:127386827-127386849 GTTGGGGACCGCTGCTGTAGTGG + Intronic
1076450428 10:130553547-130553569 GTTGGGGACCTCTGCTCTAGGGG - Intergenic
1077247102 11:1544977-1544999 TTTGGGGACCTGAAATCTAGGGG - Intergenic
1077701324 11:4444798-4444820 GTTGGGGACCCATGGTCTATAGG - Intergenic
1077837407 11:5936973-5936995 TTTCGGGACCGGTGGTATAGGGG - Intronic
1078168303 11:8910095-8910117 TTTGGAGACCTGTTCTCTTGGGG - Intronic
1078380549 11:10836134-10836156 GTTGGGGACCGCTGCTCTAAAGG + Intronic
1078396587 11:10987123-10987145 GTTGGGGACCCCTGCTCTACAGG - Intergenic
1078856760 11:15211898-15211920 ATAGGGGCCCCGTGCTCTATTGG - Intronic
1079569926 11:21930348-21930370 GTTGGGGGCCCCTGCTGTAGTGG - Intergenic
1079666033 11:23106940-23106962 TTTGGGGACCCATTTTCTAAAGG - Intergenic
1080884495 11:36353862-36353884 GTTGGGGACCCCTGCTCCAGAGG + Intronic
1082841472 11:57693461-57693483 GTTGGGGACCCCTGCTTTAGTGG + Intronic
1083551888 11:63596345-63596367 GTTGGGGACCGCTGCTGTAGAGG - Intronic
1084794586 11:71496596-71496618 GTTGGTGACCCCTGCTCTAGGGG + Intronic
1084967956 11:72754107-72754129 GTTGGGGACCTCTGCTCTAAGGG - Intronic
1085465667 11:76721746-76721768 TCTGGGGACCCGTACTGTGGGGG + Intergenic
1085654066 11:78296248-78296270 GCTGGGGACCCCTGCTCTAGGGG + Intronic
1086340788 11:85846219-85846241 TTTTGGGATACTTGCTCTAGAGG - Intergenic
1087283213 11:96235431-96235453 TTTGCTGACCCCTGATCTAGAGG + Intronic
1087714053 11:101586657-101586679 GTTGGGGACCACTGTTCTAGAGG - Intronic
1088696547 11:112370943-112370965 TTTAGGAACCTGTGCTTTAGAGG + Intergenic
1089215448 11:116832013-116832035 GTTGGGGACCCCTGGGCTAGGGG + Intronic
1090091735 11:123703993-123704015 TTTGGACACCCCTGTTCTAGGGG - Intergenic
1090230985 11:125103404-125103426 ATTGGGGATCAGTGCTCTAGGGG + Intronic
1090785349 11:130043418-130043440 TTTGGGAAACTCTGCTCTAGGGG + Intergenic
1091212244 11:133872012-133872034 GTTGGGGACCACTGCTGTAGAGG + Intergenic
1091574504 12:1720760-1720782 GTTGGGGACCCCTGCTGTATAGG + Intronic
1092094886 12:5833529-5833551 ATTGGGGACCCCTGTTCTAAAGG - Intronic
1092590234 12:9946553-9946575 GTTGGGGACTGCTGCTCTAGGGG + Intergenic
1093168214 12:15829553-15829575 CTTGGGGACCCCTGATATAGGGG + Intronic
1093331152 12:17841769-17841791 GTTGGGGACCCCTGCTGTAAAGG + Intergenic
1093832235 12:23776560-23776582 GTTGGGGACCACTGCTCTAAGGG - Intronic
1094167458 12:27457100-27457122 GTTGGGGACCACTGGTCTAGAGG + Intergenic
1095145941 12:38726132-38726154 GTTGGGGACCCCTGGTCTACAGG + Intronic
1095393961 12:41741977-41741999 GTTGGGGACCACTGCACTAGAGG - Intergenic
1095656192 12:44672178-44672200 GTTGGGGACCCCTGTTCTATGGG - Intronic
1096431242 12:51545048-51545070 GCTGGGGACCCCTGCTGTAGAGG - Intergenic
1097968933 12:65611432-65611454 TTTGGGGTTCTGTGCTCTATTGG - Intergenic
1099222276 12:79929328-79929350 TTTGTGAACCCCCGCTCTAGAGG + Intronic
1099270079 12:80497534-80497556 ATTGGGGACCCCTGTTATAGAGG + Intronic
1100401639 12:94235589-94235611 TTTGCCGACCTCTGCTCTAGAGG - Intronic
1100416876 12:94387177-94387199 TTTGGGGACCCTTGCTTTAGAGG - Intronic
1101647532 12:106645107-106645129 ATTGGGGACACGTGATCTGGAGG + Intronic
1101955966 12:109212756-109212778 TTTGGGGACCCTTTCTTTAGGGG + Intronic
1102329161 12:112014163-112014185 GTTGGGGACCCCTGCTTTACAGG - Intronic
1102827600 12:115962481-115962503 GTTGGGGACCCCTGCTCTAGGGG + Intronic
1103498672 12:121383279-121383301 TTTGGAGAGCAGTGCTTTAGAGG + Intronic
1105200685 13:18172264-18172286 GTTGGGGACCCCTGCTATAGAGG + Intergenic
1105229964 13:18484625-18484647 TTTGGGAAGCTGTGCTCCAGTGG - Intergenic
1105500890 13:20970780-20970802 GTTGGGGACCCCTGCTTTAATGG + Intergenic
1106195915 13:27493722-27493744 TTTGGGGGGCCCTGCTCTAAAGG - Intergenic
1107603165 13:42033622-42033644 ATTGGGGACCGCTGCCCTAGCGG + Intergenic
1108174637 13:47779548-47779570 TTTGGGGACCACTGCTTTAGAGG - Intergenic
1108534231 13:51356970-51356992 TTTGCTGACCCCTGCTTTAGAGG - Intronic
1109176664 13:59166306-59166328 GTTGGGGACCCCTGCCCTAAAGG - Intergenic
1110247509 13:73342929-73342951 GTTGGGGAACGCTGCTCTAGAGG + Intergenic
1110743586 13:79026499-79026521 TTTAGGGACCCCTGCTATAATGG + Intergenic
1111454618 13:88464927-88464949 GTTGGGGACCCCTGCTATAAAGG - Intergenic
1111924393 13:94447188-94447210 GTTGGGGACCGGTGGTGTAGAGG - Intronic
1112298704 13:98211170-98211192 TCTGGGGACCCCTCCTTTAGAGG - Intronic
1113467004 13:110519958-110519980 TATGGGGATCCGTGTGCTAGGGG + Intergenic
1113757447 13:112823003-112823025 CTCAGGGACCCCTGCTCTAGAGG + Intronic
1113768573 13:112895022-112895044 TTTGGGGACCTGTGGCCAAGGGG - Intronic
1114233337 14:20803095-20803117 TTTGGGCACCAGTGCTGTAGTGG - Exonic
1114615529 14:24065987-24066009 TTTGGGAAACAGAGCTCTAGAGG - Intronic
1115035668 14:28853662-28853684 TTTGGGGACCACTGATCTACTGG + Intergenic
1115955745 14:38777284-38777306 GTTGGGGACCACTGATCTAGGGG - Intergenic
1116099195 14:40410534-40410556 TTAGGGGCCCCATGCTTTAGAGG - Intergenic
1116574544 14:46556250-46556272 GTTGGGGACCCCTGCTCTTAAGG + Intergenic
1117404825 14:55391986-55392008 GTTGGGGACCACTGCTTTAGGGG - Intronic
1117559179 14:56918203-56918225 TTTGGGGACCCCTGATCTAGAGG + Intergenic
1121099229 14:91238620-91238642 TTTGGGGACACGAGCTGCAGTGG - Intronic
1122190217 14:100036302-100036324 GTTGGGGACCGCTGCTCTATGGG + Intronic
1122884435 14:104704396-104704418 GTTGGGGACCCTTGTTCTAGTGG - Intronic
1123965543 15:25453363-25453385 GTTGGGGACCCCTGCTTTACAGG - Intergenic
1124386266 15:29210356-29210378 CTTGGGGACCCCTGATCTAGGGG - Intronic
1126489868 15:49225278-49225300 ATTGGGGAACCCTGCTCTACAGG - Intronic
1126721163 15:51581377-51581399 GTTGGAGACCGCTGCTCTAGAGG + Intronic
1127254960 15:57281972-57281994 GTTGGGGACCACTGCTTTAGAGG + Intronic
1127477384 15:59347399-59347421 GTTGGGGACTGCTGCTCTAGAGG + Intronic
1127863338 15:63012425-63012447 TTTGAGGACACTTGCTCCAGTGG - Intergenic
1127901105 15:63341592-63341614 GTTGGGGACCACTGATCTAGAGG + Intronic
1128086299 15:64888928-64888950 GTTGGGGATCACTGCTCTAGGGG - Intronic
1128086353 15:64889203-64889225 TTTGGGAACCCCTGCCCTAGAGG + Intronic
1129312604 15:74722993-74723015 TTTGGGGACCTGAGGTCTTGAGG + Exonic
1129813229 15:78528104-78528126 TTTGGGGACTCCTGTACTAGAGG - Intronic
1130179229 15:81608120-81608142 CTTGGGGACCTGAGCTCTGGAGG + Intergenic
1131179790 15:90231921-90231943 TTTGAGGAACCGTGTTCTAGAGG - Intronic
1131999163 15:98162465-98162487 TTTGGGGAGCCCAGCCCTAGGGG - Intergenic
1132130777 15:99276349-99276371 GTTGGGGACCGCTGCTCTAAGGG + Intronic
1132257396 15:100388034-100388056 GTTGGGGACCCCTATTCTAGGGG - Intergenic
1132379057 15:101353462-101353484 GATGGGGACCCCTGCTCTTGTGG + Intronic
1132532741 16:461347-461369 GTTGGGGACCCCTGCTGTAAAGG + Intronic
1133120001 16:3600347-3600369 GTTGGGGACCCCTGCACTAGAGG + Intronic
1133441325 16:5823477-5823499 TTTGGGGACCCCAGCCATAGAGG - Intergenic
1133621003 16:7526264-7526286 TTTGGGGACTGCTGCCCTAGAGG + Intronic
1133909280 16:10050266-10050288 TTTGGGGATCCCTACTCCAGAGG - Intronic
1134787252 16:16955853-16955875 GTTGGGGACCCCTGCTGTATCGG - Intergenic
1135056901 16:19239388-19239410 TTTGAGGAAACGTGCTGTAGTGG + Intronic
1135464249 16:22671611-22671633 TTTGCAGACCCCTGCCCTAGAGG - Intergenic
1137576659 16:49604482-49604504 TTTGAGAACCAGTGATCTAGTGG + Intronic
1138109577 16:54312821-54312843 GTTGGGGACCCCTGCTGTATGGG + Intergenic
1141231039 16:82167886-82167908 GTTGGGGACCCATGCTATATAGG + Intronic
1141400315 16:83741775-83741797 GTTGGGGACCCCTGATGTAGGGG - Intronic
1141991017 16:87609769-87609791 GTTGGGGACCATTGGTCTAGAGG - Intronic
1142116851 16:88361338-88361360 GTTGGGGACCCCTGCCCTAGAGG + Intergenic
1142809820 17:2390336-2390358 TTTGGGGTCCCCCGCCCTAGGGG - Intronic
1143602000 17:7953149-7953171 GTTGGGGACCACTGCTCTAGGGG - Intergenic
1143727582 17:8860157-8860179 TTTGGGGACCCTTGGGCCAGAGG - Intronic
1143908355 17:10227441-10227463 GTTGGGGACCCCTGCAGTAGAGG + Intergenic
1144390045 17:14784850-14784872 TTTGGGGAGCCCAGATCTAGGGG + Intergenic
1144940647 17:18937596-18937618 GTTGGGGACCCCTGATCCAGGGG + Intergenic
1146496933 17:33330956-33330978 GTTGGGGACCCCTGGTCTAAGGG - Intronic
1146708502 17:35020245-35020267 GTTGGGGACCCTTGATCTATAGG - Intronic
1147617844 17:41840755-41840777 TTTGCAGACCCCTGCTCTAGAGG + Intronic
1148622976 17:49048633-49048655 TTTGGGGACTCCTGTTGTAGAGG - Intronic
1149774259 17:59344885-59344907 GTTGGGGACCACTGCTCTAGAGG - Intronic
1150417704 17:65000891-65000913 GTTGGGGACCCCTGTCCTAGGGG - Intergenic
1151263668 17:72937009-72937031 GTTGGGGACCCTTGCGGTAGAGG + Intronic
1151778310 17:76224606-76224628 ATTAGGCACCCTTGCTCTAGGGG - Intronic
1152517130 17:80832189-80832211 ATTGGGAACCCGTGATCCAGGGG + Intronic
1152945294 17:83194617-83194639 GTTGGGGACCACTGCTCTGGTGG - Intergenic
1152945349 17:83194905-83194927 CCTGGGGACCCCTGCTCCAGAGG + Intergenic
1153021747 18:635475-635497 GTTGGGGACCCCTGCTATAAAGG + Intronic
1154523439 18:15255216-15255238 TTTGGGAAGCTGTGCTCCAGTGG + Intergenic
1155762576 18:29586344-29586366 GTTGGGGACCCCTGCACTAGAGG - Intergenic
1156009662 18:32481734-32481756 GTTGGGGACCCATGGTTTAGAGG + Intergenic
1156432876 18:37094298-37094320 GTTGGGGACCCCTGCCTTAGAGG + Intronic
1156682649 18:39609584-39609606 GTTGGACACCCGTGCTCTAGAGG - Intergenic
1157363718 18:47044097-47044119 TTTGGACACCCTTGCCCTAGAGG - Intronic
1157389381 18:47288517-47288539 TTTGGGGACTCCTGTTCTTGGGG + Intergenic
1157423139 18:47562788-47562810 GTTGGGGACCCCTGCTGTAAAGG - Intergenic
1157540146 18:48495853-48495875 GTTGGGGTCCCCTGCTCTAGGGG - Intergenic
1157795728 18:50573250-50573272 GTTGGGGACCCCTGGTCTAGAGG - Intronic
1158896812 18:61921952-61921974 GTTGGGGACCCCTGCTCTAGAGG - Intergenic
1159604963 18:70465811-70465833 CTTGGGGACCCCTGATATAGGGG - Intergenic
1160192511 18:76725752-76725774 GTTGGGGACCACTGCTTTAGAGG - Intergenic
1160271280 18:77386590-77386612 GTTGGGGACCCCTGCTTTAAAGG - Intergenic
1161870184 19:6863878-6863900 TTTGGGGAGCCGTGGTGTGGGGG + Intergenic
1161988870 19:7672718-7672740 GCTGGGGACCCCTGTTCTAGTGG + Intergenic
1162175354 19:8826167-8826189 GTTGGGGACCACTGCTCTAGAGG - Intronic
1162175431 19:8826692-8826714 GCTGGGGACTCCTGCTCTAGAGG + Intronic
1162265185 19:9567454-9567476 GTTGGGGACCTCTGCTCTAGAGG - Intronic
1162866254 19:13549624-13549646 TTTGGTGATCCCTGATCTAGAGG - Intronic
1163384108 19:16988730-16988752 GTTGGGGACCCCTGCTCTAAGGG - Intronic
1164450167 19:28354995-28355017 GTTGGGGACCCTTGTTCTAGAGG - Intergenic
1164494552 19:28748093-28748115 ATTGGGGACCCCTGGCCTAGAGG - Intergenic
1166106323 19:40599918-40599940 TATGGGGACCAGGCCTCTAGTGG - Intronic
1167239437 19:48334330-48334352 TCTGGGGACCCGTACTGAAGAGG - Intronic
925462292 2:4074002-4074024 GTTGGGGACCCCTGCTGTAAAGG - Intergenic
925825261 2:7842014-7842036 CTTGGGGACCCCTGCCCTAATGG + Intergenic
926995442 2:18730253-18730275 TTTGAGGACCCCTGCTTTACAGG - Intergenic
927259502 2:21072747-21072769 CTTGGGGACCCCTGATCTATAGG + Intergenic
927339584 2:21966921-21966943 TTTGGGTACCCTTGCTATATTGG + Intergenic
927587281 2:24319127-24319149 GTTGGGGACCAGTGATCTAGAGG + Intronic
928040571 2:27872184-27872206 GTTGGGGACCCCTGCTCTACAGG + Intronic
928239798 2:29576597-29576619 GTTGGGGACCTGTGCTCCAGAGG - Intronic
928259960 2:29757684-29757706 TTTGCTGACCTCTGCTCTAGTGG - Intronic
929070266 2:38021917-38021939 TTTAGGGACCCCTGCTATAGAGG + Intronic
929264101 2:39899370-39899392 ATTGGGGACCCCTGCTTTAAAGG - Intergenic
929264153 2:39899697-39899719 GTTGGGGACCATTGCTCTAGGGG + Intergenic
929880255 2:45830192-45830214 TTCAGGGACCCATGCTCTAATGG + Intronic
931550987 2:63446161-63446183 ATTGGGGACCCCTGGTTTAGAGG - Intronic
931650676 2:64466011-64466033 GTTGGGGACCCCTGGTCTAAAGG + Intergenic
932599603 2:73114327-73114349 GTTGGGGACCCCTGCTATAGAGG - Intronic
933559771 2:83875346-83875368 TTTCGGGACCGGTGGTATAGGGG + Intergenic
933674068 2:85037756-85037778 GTTGGGGAACCCTGGTCTAGAGG - Intronic
934625815 2:95849955-95849977 GTTGGGGACCCCTGCTATAGAGG + Intronic
934807760 2:97251363-97251385 GTTGGGGACCCCTGCTATAGAGG - Intronic
934829750 2:97505824-97505846 GTTGGGGACCCCTGCTATAGAGG + Exonic
935096563 2:99949835-99949857 GTTGGGGACTCTTGCTCTAAAGG + Intronic
935108695 2:100072113-100072135 GTTGGGGACCCCTGATTTAGAGG - Intronic
936228944 2:110682506-110682528 ATTGGGGACCCCTGTGCTAGGGG + Intergenic
938522741 2:132088086-132088108 TTTGGGAAGCTGTGCTCCAGTGG + Intergenic
939370386 2:141291962-141291984 GTTGGGGACCCCTGGTATAGGGG - Intronic
940853223 2:158707610-158707632 CTTGGGGACCCCTGATTTAGAGG + Intergenic
941327189 2:164131147-164131169 GTTGGGGACTCCTGCTCTACAGG - Intergenic
942420454 2:175801611-175801633 GTTGGGGACCCCTGCTTTAAAGG + Intergenic
942479459 2:176368432-176368454 GTTGGGGACCCCTGGTCTAATGG - Intergenic
942565026 2:177257632-177257654 GGTGGGGACCCCTGCCCTAGGGG - Intronic
943156657 2:184187807-184187829 TTTGGGGACCACTGGGCTAGAGG + Intergenic
943244647 2:185431277-185431299 TTCGGGGACTCCTGCTCTAAGGG - Intergenic
943657749 2:190527637-190527659 GTTGGGGACCTTTGCTCTAGAGG - Intronic
943905784 2:193499955-193499977 GTTGGGGACCCCTGGTCTAGAGG + Intergenic
946373132 2:219292699-219292721 ATTGGGGACCCCTGCTTTAGAGG - Intronic
946500756 2:220244953-220244975 GTTGGTGACCCCTGGTCTAGAGG + Intergenic
946934090 2:224701368-224701390 GTTGGGGACCCTTGTGCTAGGGG + Intergenic
947208233 2:227682166-227682188 TTTGGGGACCACTGCTCTAGAGG - Intergenic
1168747371 20:254963-254985 GTTGGGGACCCCTGGCCTAGAGG + Intergenic
1170586769 20:17740765-17740787 TTTGGGGATCAGTGGGCTAGGGG - Intergenic
1170670222 20:18426050-18426072 GTTGGGGACCCCTGGTCTACCGG - Intronic
1172280444 20:33704000-33704022 GTTGGGGACTGCTGCTCTAGGGG - Exonic
1172382416 20:34506394-34506416 GTTGGGGACCCCTGCTTTAATGG - Intronic
1172461375 20:35121545-35121567 TTGGGGAATCCCTGCTCTAGAGG + Intronic
1173032906 20:39378929-39378951 TTTGGGAATCCGAGCTCTGGTGG - Intergenic
1173069363 20:39746957-39746979 TATGGGGACCCCTGCCTTAGTGG - Intergenic
1173891673 20:46517223-46517245 TCTGGGGACCACTGCTCTATGGG - Intergenic
1174290277 20:49503502-49503524 GTTGTGGACCCCTGCTCTAATGG + Intergenic
1174319276 20:49727968-49727990 TTTGCTCACCTGTGCTCTAGTGG - Intergenic
1174455870 20:50648442-50648464 GTTGGGGACCGCTGCTTTAGAGG - Intronic
1174455946 20:50648957-50648979 GTTGGGAACCCTTGCTCTAAAGG + Intronic
1174635522 20:51996211-51996233 ATTGGGGACTGCTGCTCTAGGGG - Intergenic
1174886290 20:54339087-54339109 GTTGGGGACCACTGCTCTAAAGG - Intergenic
1175255825 20:57646634-57646656 TTTGGTGACCCCTGGTCTAGAGG + Intergenic
1176773955 21:13112971-13112993 TTTGGGAAGCTGTGCTCCAGTGG - Intergenic
1178415876 21:32404739-32404761 GGTGGGGACCGCTGCTCTAGTGG - Intergenic
1180521567 22:16212694-16212716 TTTGGGAAGCTGTGCTCCAGTGG - Intergenic
1181480642 22:23196927-23196949 GTTGGGGACCCCTGCCCTTGGGG + Intronic
1182745202 22:32600479-32600501 GTGGGGGACCCCTGCTCCAGAGG + Intronic
1183503773 22:38197058-38197080 TTTGGGGACCCCTGCTGTAGAGG + Intronic
1183621585 22:38976280-38976302 TTTGAGGACTGCTGCTCTAGAGG + Intronic
949564249 3:5230372-5230394 GTTGGGGACCCCTGATCTAGTGG - Intergenic
951707067 3:25554078-25554100 TTTGTAGACCCCTGCTCCAGAGG - Intronic
952158314 3:30667919-30667941 TTTGCTGACCCCTGTTCTAGAGG - Intronic
953227406 3:41033385-41033407 GTTGGGGACCGCTGCTCTATGGG - Intergenic
953768574 3:45762059-45762081 TTTGGGCAGCGCTGCTCTAGTGG - Intronic
956104360 3:65801799-65801821 TTTGGGGACCCCTGCTTTAGGGG - Intronic
957068595 3:75547311-75547333 TTTGGGGAACCGTGCTTTTATGG - Intergenic
957459077 3:80494243-80494265 GTTGGGGACCCCTGCTTTAGAGG - Intergenic
957459131 3:80494566-80494588 TTTGGGGACCACTGCTCTAAAGG + Intergenic
959644077 3:108677921-108677943 GTTGGGGACCTCTGATCTAGTGG - Intronic
960096215 3:113692187-113692209 CTTGGGGACCCCTGCCTTAGAGG + Intronic
960537546 3:118830115-118830137 TTTGGGGATCCCTGCTATAAAGG - Intergenic
961195041 3:124994340-124994362 GTTGGGGACCCCTGCCCCAGAGG + Intronic
961320506 3:126070208-126070230 GTTGGGGACCCCTGCTCTAAAGG - Intronic
961519533 3:127458892-127458914 CCTGGAGACCCCTGCTCTAGCGG - Intergenic
962332189 3:134488007-134488029 TTTGGGGGCCCCTGGTTTAGAGG - Intronic
962995966 3:140628786-140628808 TTTGGGGTCACGTGATCTAAAGG - Intergenic
963361013 3:144271826-144271848 TTTGGGGAGCAGGGCTGTAGGGG + Intergenic
965725426 3:171710653-171710675 GTTGGCGACCCCTGCTCTAGAGG + Intronic
966163451 3:176991491-176991513 TTTGGGGACCCCTGCTCTAGAGG + Intergenic
967068746 3:185943596-185943618 GGTGGGAACCGGTGCTCTAGAGG - Intergenic
968450942 4:675656-675678 GTTGGGGACCCCTGCCCTATAGG - Intronic
969076445 4:4582581-4582603 ATTGGGGACCGCTGCTCTACGGG - Intergenic
969699168 4:8756917-8756939 GTTGGGGACCCCTGCTTCAGTGG - Intergenic
970314948 4:14820285-14820307 TTTGCTGGCCCTTGCTCTAGAGG + Intergenic
971755258 4:30699385-30699407 GTTGGGGACCCCTGGTTTAGAGG + Intergenic
972362548 4:38341238-38341260 GTTGGGGACCACTGCTCTAGAGG + Intergenic
972368669 4:38399950-38399972 GTTGGGGACCCCTGCTCTTGAGG + Intergenic
973611834 4:52643327-52643349 TTTGCAGACCTGTGGTCTAGTGG - Intronic
974356884 4:60824247-60824269 TTTGGGGACTGCTGCTCCAGAGG + Intergenic
974760461 4:66267052-66267074 TTTTGGGACCTCTGCTCTTGAGG - Intergenic
975477870 4:74843869-74843891 GTTGGGGAACCCTGCTCTATGGG - Intergenic
977173330 4:93789806-93789828 ATTGGGGACTCCTGCTCTAGAGG - Intergenic
977910159 4:102524967-102524989 TTTGGGGACGCCTGCACTAGAGG + Intronic
978316164 4:107439801-107439823 GTTGGGGACCCCTGATCTATTGG + Intergenic
978367941 4:108002154-108002176 GTTGGGGACCCCTGCTCTGGAGG - Intronic
978637309 4:110824666-110824688 GTTGGGGACCCCTGTTCTAGAGG + Intergenic
979228842 4:118323115-118323137 TTTGCAGACCCCTGCTCTAGAGG + Intronic
979437496 4:120711166-120711188 TTTGAGAACCCTTGATCTAGAGG + Intronic
979566304 4:122157667-122157689 GTTGGGGACCCCTGATCTAGGGG + Intronic
979852535 4:125591598-125591620 TTTGGGGACTCCTGCTGTATAGG + Intergenic
980901051 4:138905612-138905634 GTTGGGGACCTGTGAACTAGAGG - Intergenic
981103887 4:140858822-140858844 TTTGGGGATCCCTGGTCTAGTGG + Intergenic
981591299 4:146365812-146365834 CTTGGGGACCCCTGCTGAAGAGG - Intronic
981609492 4:146578085-146578107 GTTGGGGGCCCCTGCTTTAGAGG + Intergenic
981691559 4:147514868-147514890 TTTGAGGATCACTGCTCTAGAGG - Intronic
981779988 4:148417958-148417980 TATAGGGACCTGTGCTTTAGAGG - Intronic
981919903 4:150076359-150076381 ATTGGACACCCCTGCTCTAGAGG + Intergenic
982164740 4:152604390-152604412 GTTTGGGACCCCTGCTCTAAAGG - Intergenic
982278526 4:153660986-153661008 GTTGGGGACTCCTGCTCTAAAGG - Intergenic
983420480 4:167509163-167509185 TTTGGGGACCTCTGCCTTAGAGG + Intergenic
983578734 4:169286584-169286606 TTTGGGGACTACTGATCTAGAGG - Intergenic
983652663 4:170048984-170049006 GTTGGGCAACCCTGCTCTAGGGG + Intergenic
983703191 4:170623663-170623685 GTTGGGAACTCCTGCTCTAGGGG + Intergenic
984311679 4:178068428-178068450 CTTGGGGACCCCTGTTCTAGGGG + Intergenic
986122427 5:4853812-4853834 GTGGGGGACCCGTGTTTTAGAGG + Intergenic
987023821 5:13902702-13902724 TTTGCTGACCCCTGCCCTAGAGG + Intronic
988452462 5:31357063-31357085 TTTGGGGACCACTGTTCTCGAGG - Intergenic
989552331 5:42750561-42750583 GTTGGGAACCCCTGCTCTAGAGG - Intergenic
989730382 5:44641383-44641405 TTTGGGGAGCCCTGACCTAGGGG - Intergenic
990593688 5:57292348-57292370 TTTGACAACCCTTGCTCTAGAGG - Intergenic
990595039 5:57304103-57304125 TTTGGGAAGCCCTGCTCTGGAGG + Intergenic
990612172 5:57468579-57468601 TTTGGGGACCCCTGCCGTAAGGG + Intergenic
991036861 5:62135968-62135990 GTTGGGGACCCCTGTTTTAGAGG + Intergenic
991272639 5:64803172-64803194 TTTGAGGACCAGTGCTTTAGGGG + Intronic
992116687 5:73545145-73545167 GCTGGGAACCCCTGCTCTAGCGG - Intergenic
992211406 5:74483546-74483568 GTTGGGGACCCCTGCTATATAGG - Intergenic
992652725 5:78876723-78876745 TTGGGGGACCTCTGCTCTAAGGG - Intronic
993140327 5:84025200-84025222 GTTGGGGACCCCTGGACTAGAGG - Intronic
993425994 5:87764950-87764972 GTTGGGGATCGCTGCTCTAGAGG - Intergenic
993828986 5:92729575-92729597 TTTGGGGACTGCTGCTCTAGTGG + Intergenic
994445112 5:99862459-99862481 TTTGTGGACCCTTGCTCAAATGG - Intergenic
995173760 5:109149385-109149407 GTTGGGGACCCCTGGTCTAAGGG - Intronic
995911752 5:117196233-117196255 GTTGGGGACCACTGCTCTATAGG - Intergenic
997052903 5:130403364-130403386 GCTGGGGACCACTGCTCTAGAGG + Intergenic
997221984 5:132176825-132176847 TCTGGGGACCACTGCCCTAGGGG + Intergenic
997689401 5:135815473-135815495 GTTGGGGACCCCTGCTATAAAGG + Intergenic
997693840 5:135845953-135845975 GTTGGGGACCCCTGGTCTAGAGG - Intronic
999459609 5:151746558-151746580 TTTGCCGATCCCTGCTCTAGAGG - Intronic
1000011837 5:157240485-157240507 GTTGGGGACTGCTGCTCTAGAGG + Intronic
1000224848 5:159250495-159250517 GTTGGGGACCCCTGCTTTAAAGG + Intergenic
1001225442 5:169940866-169940888 GTTGGGGACCCCAGATCTAGTGG + Intronic
1001349286 5:170941918-170941940 TTTGGGGACCCCTGTTCTAGAGG - Intronic
1001756014 5:174170709-174170731 GTTGGGGACCACTGCTCTAAAGG - Intronic
1002567328 5:180119298-180119320 TCGGGGGACCCGTGCACTGGGGG + Intronic
1002813687 6:659303-659325 TTTGGGAAACACTGCTCTAGAGG - Intronic
1002858979 6:1063032-1063054 GTGGGGGACCTGTGCTCTAGAGG - Intergenic
1003231930 6:4262134-4262156 GTTGGGGACCCCTGGTTTAGAGG - Intergenic
1003349426 6:5302132-5302154 TTAGGGGAGCAGAGCTCTAGAGG - Intronic
1004311960 6:14553824-14553846 GTTGGGGACCCCTGCTCTAGAGG + Intergenic
1004476604 6:15979260-15979282 CTTGGGGATCACTGCTCTAGAGG - Intergenic
1004632727 6:17437250-17437272 GTTGGGGACCACTGGTCTAGTGG + Intronic
1004933789 6:20487942-20487964 TTTGCTGACCCCTGCTCTAGAGG + Intronic
1008126960 6:47679400-47679422 TTTGCTGACCCTTGCTTTAGAGG - Intronic
1008239678 6:49094219-49094241 TTTGCTGACTCCTGCTCTAGAGG - Intergenic
1009920916 6:70060368-70060390 GTTGGGGACCCCTGCTGTAGAGG - Intronic
1011170510 6:84499555-84499577 TTTGCTGACCCCTGCTCTAAAGG - Intergenic
1012395395 6:98790674-98790696 GTTGGGGACTGTTGCTCTAGAGG - Intergenic
1012395446 6:98790992-98791014 GTTGGGGACTCCTACTCTAGAGG + Intergenic
1013036264 6:106386875-106386897 ATTTGGGACCCCTGCTCTAGAGG + Intergenic
1013740713 6:113280588-113280610 GTTGGGGACCCCTGGTCTAGAGG + Intergenic
1014720515 6:124911950-124911972 GTTGGGGACCCCTGCTCTAGAGG + Intergenic
1016462813 6:144296116-144296138 GTTGGGGAGCCCTGTTCTAGTGG - Intronic
1016518067 6:144918856-144918878 GTTGGGGACCACTGGTCTAGTGG + Intergenic
1016773218 6:147875535-147875557 GCTGGGGACCCCTGTTCTAGGGG - Intergenic
1017737128 6:157375536-157375558 TTTGGGGATCCCTGCTCTAGGGG - Intergenic
1017737203 6:157376062-157376084 GTTGGGGACCACTGCCCTAGAGG + Intergenic
1018019483 6:159746187-159746209 ATTGGATACCCCTGCTCTAGAGG + Intronic
1018512490 6:164540460-164540482 GTTGGGGACCCCTGCTCTAGAGG - Intergenic
1018512558 6:164540975-164540997 TTTGGGGACCACTGCTCTAGAGG + Intergenic
1018811454 6:167301111-167301133 TTTGCTGGCCCCTGCTCTAGAGG + Intronic
1019884335 7:3891033-3891055 TTTTGGGACCCAGGCTCTGGTGG + Intronic
1021372321 7:19863893-19863915 TTTGAGCACCAGTGCTTTAGGGG + Intergenic
1021498934 7:21307906-21307928 GTTGGGGACCTCTGCTGTAGGGG + Intergenic
1021652573 7:22846272-22846294 TTTGGGTACCACTGCTCTAGGGG - Intergenic
1021877642 7:25063565-25063587 TTTGGGGACCGCTGCTTTAGAGG + Intergenic
1022708577 7:32830589-32830611 CTTGGAGACCCCTGCTCTAGAGG - Intergenic
1022708633 7:32830924-32830946 GTTGGGGACTGCTGCTCTAGAGG + Intergenic
1022914600 7:34934888-34934910 CTTGGAGACCCCTGCTCTAGAGG + Intronic
1023381514 7:39612951-39612973 GTTGGGGACGACTGCTCTAGGGG - Intergenic
1023742612 7:43294099-43294121 TTTGGGGACCGCTGCTGCAGGGG + Intronic
1024015169 7:45307225-45307247 GTTGGGGACCACTGCTCTAAAGG - Intergenic
1024626595 7:51213203-51213225 GTTGGGGACCGCTGCTGTAGAGG - Intronic
1024659910 7:51483601-51483623 GTTGGGAACCCCTGCACTAGGGG - Intergenic
1024758718 7:52568236-52568258 TTTGGGGACCCCTGGTGTAGAGG + Intergenic
1025108149 7:56190305-56190327 GTTGGGGACCCCTGCTCTTATGG + Intergenic
1025656499 7:63524529-63524551 GTTGAGGACCCCTGCCCTAGGGG - Intergenic
1025806117 7:64836181-64836203 TTTTGGGACCGGTGGTATAGGGG + Intergenic
1026310089 7:69175797-69175819 GTTGGGGACCCCTGCTCTAATGG - Intergenic
1026553751 7:71388883-71388905 GTTGGGGACCCCTGCTCTAGAGG - Intronic
1026624422 7:71979671-71979693 GTTGGGGACCCCTGCTCTATGGG + Intronic
1027482656 7:78718320-78718342 GTTGAGGACCCCTGGTCTAGAGG - Intronic
1027787791 7:82602133-82602155 GTTGGGGACCCCTGTTCTACAGG - Intergenic
1028570260 7:92278952-92278974 GTTGGGGACCACTGCTCTAGGGG - Intronic
1028570309 7:92279271-92279293 TTTGGGGACCCCTGCCCTAAAGG + Intronic
1030323231 7:108192091-108192113 TTTGGGGACCCGTGCTCTAGAGG - Intronic
1030323295 7:108192541-108192563 GTTGGGGACCACTGCTCTAGAGG + Intronic
1030626344 7:111849732-111849754 TCTGGGGACCCCTGCTCCAGTGG - Intronic
1031094626 7:117403740-117403762 GTTGGGGACCCCTGCTATAGTGG - Intronic
1032058620 7:128704835-128704857 GCTGGGGACCCCTGCTTTAGTGG + Intergenic
1032188133 7:129745322-129745344 ACTGGGGACCCCTGCTCTGGAGG - Intronic
1032792898 7:135255456-135255478 GTTGGGGACCCCTGCCCTAGAGG - Intronic
1033821846 7:145143938-145143960 TTTGCTGAACCTTGCTCTAGAGG + Intergenic
1033980249 7:147155484-147155506 TCTGGGTACCGGTTCTCTAGGGG - Intronic
1034253708 7:149713503-149713525 GTTGGGGACCCCTGATTTAGGGG + Intergenic
1034521455 7:151623577-151623599 GTTGGGGACCCCTGCTCTAGTGG + Intronic
1034733643 7:153410167-153410189 TTTTGGGACCGGTGGTATAGGGG + Intergenic
1034987393 7:155524843-155524865 GTTGGGGACCGCTGCTCTAAGGG + Intronic
1035227794 7:157443155-157443177 GTTGGGGACCCCTGCTGTTGGGG + Intergenic
1035353960 7:158265984-158266006 GTTGGGGACCCCTGGTCTGGAGG + Intronic
1036888147 8:12575519-12575541 TTTGGGGAACCGTGCTTTTATGG - Intergenic
1037207744 8:16343811-16343833 TTTGGGGACTGCTGCTCTAAAGG + Intronic
1037241846 8:16786239-16786261 GCTGGGGACCCCTGCTTTAGGGG - Intergenic
1039375499 8:37028712-37028734 ATTGGGGACCCTTGCTCTATGGG - Intergenic
1041147631 8:54894542-54894564 GTTGGAGTCCTGTGCTCTAGAGG + Intergenic
1041867046 8:62585718-62585740 ATTGGGAACCCCTGCTTTAGGGG + Intronic
1042273118 8:66975932-66975954 GTTGGGGACCCCTGCACTATAGG - Intronic
1042910879 8:73824864-73824886 GTTGGGGACCCCTGGCCTAGAGG + Intronic
1043204659 8:77421978-77422000 TTTGGGGACCCCTGCTTTGAAGG + Intergenic
1043522776 8:81064132-81064154 GTTGGGGACCACTGCTTTAGAGG - Intronic
1043783139 8:84362408-84362430 GTTGAGGACCCCTGCTCTAGAGG - Intronic
1043783184 8:84362743-84362765 TTTGGAGACCACTGCTCTGGAGG + Intronic
1043843138 8:85132775-85132797 TTTGGTAACCCCTGCTATAGAGG + Intronic
1044995658 8:97835832-97835854 CTTGGGGACCCCTGATCTACAGG - Intronic
1045086107 8:98687533-98687555 TTGGGGGACCCCTGTTCTAAAGG + Intronic
1045643855 8:104281297-104281319 GTTGGGGACCCCTGTTCTAGTGG + Intergenic
1045750290 8:105476195-105476217 GTTGGGGACCCCTGTTCCAGTGG - Intronic
1045750349 8:105476522-105476544 GTTGGGGACCCCTGCTCTAGAGG + Intronic
1045876926 8:106992530-106992552 GTTGGAGACCCCTGCTCTAAAGG - Intergenic
1045876951 8:106992735-106992757 GTTGGGGACCACTGCTTTAGAGG + Intergenic
1046202052 8:110939793-110939815 TTTGAGTACCAGGGCTCTAGGGG + Intergenic
1047941664 8:129832454-129832476 GTTGGGGACCACTGCTCTATAGG - Intergenic
1048452614 8:134547222-134547244 TTTGGTGATCAGTGCTCCAGCGG - Intronic
1048599069 8:135899745-135899767 GTTGGGGACCCCTTCTCTAGAGG - Intergenic
1049329266 8:142041399-142041421 GTTGGGGACAGCTGCTCTAGGGG - Intergenic
1050074246 9:1847133-1847155 GTTGGGGACCCCAGCTCTAGAGG + Intergenic
1050431612 9:5568221-5568243 GTTGGGGACCCCTGCCTTAGAGG - Intronic
1051000958 9:12281004-12281026 TTTGGGGACCCCTACTTTAGTGG + Intergenic
1052038033 9:23705554-23705576 GTTGGGGACCACTGCTCTAGGGG - Intronic
1052309103 9:27045058-27045080 ATTGGGGACCCCTGGTCTATAGG - Intronic
1053701427 9:40695214-40695236 TTTGGGAAGCTGTGCTCCAGTGG + Intergenic
1054411491 9:64818670-64818692 TTTGGGAAGCTGTGCTCCAGTGG + Intergenic
1054737579 9:68770813-68770835 GTTGGGGACCGCTGCTGTAGTGG + Intronic
1055699794 9:78931216-78931238 TTTGGGGACCGCTGCCTTAGAGG - Intergenic
1055784290 9:79855713-79855735 GTTGGGGACCTCTGCTATAGAGG - Intergenic
1056275094 9:84986576-84986598 GTTGGGGATCCCTGCTCTAGAGG + Intronic
1057062818 9:92020540-92020562 GTTGGGGACCGCTGCGCTAGAGG + Intergenic
1057341565 9:94206719-94206741 TTTAGGGACCACTGCTCTGGAGG + Intergenic
1057460189 9:95254069-95254091 CTTGGGGAACCCTGCTTTAGAGG + Intronic
1057572311 9:96213963-96213985 GTTGGGGACCACTGCTCTAAAGG + Intergenic
1058014582 9:100015995-100016017 TATGGGGACCCTTGTTCTAAAGG + Intronic
1059347990 9:113645312-113645334 GTTAGGGACCCCTGCTATAGAGG - Intergenic
1059499220 9:114736976-114736998 GTTGGGGACCACTGATCTAGTGG - Intergenic
1060344716 9:122806092-122806114 GTTGGGGACCACTGCTATAGAGG + Intronic
1062217336 9:135396320-135396342 TTTGGGGACCCCTGTGTTAGGGG - Intergenic
1203583668 Un_KI270746v1:41675-41697 GTTGGGGACCCCTGCTATAGAGG - Intergenic
1186079863 X:5919465-5919487 CTTGGGGACCCCTGCTGTAGAGG - Intronic
1186921876 X:14291343-14291365 TTTGATGACCCCTGCTCTAGGGG + Intergenic
1186996668 X:15131124-15131146 GTTGGGGACCCCTGGTCTAGAGG - Intergenic
1187460656 X:19484100-19484122 GTTGGGGACCCCTGCTCTAAAGG - Intronic
1187729337 X:22236756-22236778 TTTGCTAACCCCTGCTCTAGAGG + Intronic
1188400424 X:29737292-29737314 TTTGTAGACCATTGCTCTAGAGG + Intronic
1188644212 X:32544115-32544137 TTTGGTGACCCCTGGACTAGTGG + Intronic
1190261000 X:48796806-48796828 GTTGGGAACCCCTGCTGTAGAGG - Intergenic
1190261058 X:48797138-48797160 GTTGGGGACCGCTGCTCTACAGG + Intergenic
1191129190 X:56990027-56990049 ATTGGGGACCACTGCCCTAGAGG + Intronic
1191849176 X:65572928-65572950 TTTGATGACCCCTGCACTAGAGG - Intergenic
1193335910 X:80288777-80288799 TTTGGGGAACAAAGCTCTAGGGG + Intergenic
1194678287 X:96819148-96819170 GTTGGGGACCCTTGTTGTAGAGG + Intronic
1195124258 X:101790015-101790037 GTTGGAGACCCCTGCTGTAGAGG - Intergenic
1195169915 X:102257336-102257358 TTTGCAGACCCTTGCTCTAGTGG + Intergenic
1195188942 X:102429764-102429786 TTTGCAGACCCTTGCTCTAGTGG - Intronic
1195527043 X:105902912-105902934 TTTGGGGACCACTGTTGTAGTGG + Intronic
1195626326 X:107008342-107008364 TTTGAGAACCAGTGCTTTAGGGG - Intergenic
1195761234 X:108248697-108248719 GTTGGGAACCCCTGCTATAGAGG - Intronic
1196402321 X:115329541-115329563 GTTGGGGACCCCTGCCCTATGGG + Intergenic
1197261060 X:124318593-124318615 TTTGGTCACCCGTGCTTTTGAGG - Intronic
1197808797 X:130422886-130422908 GTTGGGGACCCCTGCTCTGGGGG - Intergenic
1197840055 X:130736679-130736701 TTTACTGACCCATGCTCTAGGGG + Intronic
1197999920 X:132422946-132422968 TTTGAGAACCCCTGCTCTAAGGG + Intronic
1198574418 X:137994305-137994327 TTTGCTGACCCCTGCTCTAATGG - Intergenic
1198718257 X:139586006-139586028 TTTGGGAACCCCTGCTATAAAGG - Intronic
1199739972 X:150726016-150726038 GTTGGGGATCCCTGCACTAGAGG - Intronic
1199886180 X:152024227-152024249 TTTGGGGACCCCTGGATTAGGGG - Intergenic
1199981627 X:152923861-152923883 GTTGGGGACCCCTGATCTAGGGG + Intronic
1201398626 Y:13577732-13577754 TTTGAGGACCCCTGCAGTAGTGG - Intergenic
1201514573 Y:14805161-14805183 ATTGGGGATCCCTGCTGTAGAGG + Intronic
1201677942 Y:16608537-16608559 GTTGGGGACGCCTGCTCTAATGG + Intergenic
1201944105 Y:19492917-19492939 ATTGGGGACCCTTGCCATAGAGG - Intergenic