ID: 1030325274

View in Genome Browser
Species Human (GRCh38)
Location 7:108212085-108212107
Sequence CTCCAATAGCAGCCTGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030325272_1030325274 13 Left 1030325272 7:108212049-108212071 CCGATGGTTCACATCACAGGACT 0: 1
1: 0
2: 1
3: 10
4: 119
Right 1030325274 7:108212085-108212107 CTCCAATAGCAGCCTGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030325274 Original CRISPR CTCCAATAGCAGCCTGGAGA TGG Intronic
No off target data available for this crispr