ID: 1030329619

View in Genome Browser
Species Human (GRCh38)
Location 7:108257206-108257228
Sequence CTGACTATAAACAGGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030329615_1030329619 -4 Left 1030329615 7:108257187-108257209 CCTGGGGTAGGAGAGGAGACTGA 0: 1
1: 0
2: 2
3: 37
4: 426
Right 1030329619 7:108257206-108257228 CTGACTATAAACAGGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030329619 Original CRISPR CTGACTATAAACAGGCAGGA GGG Intronic
No off target data available for this crispr