ID: 1030333162

View in Genome Browser
Species Human (GRCh38)
Location 7:108294810-108294832
Sequence AAACTAAGCATGTCCAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 6, 3: 30, 4: 319}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030333162_1030333163 5 Left 1030333162 7:108294810-108294832 CCTTTTTTGGACATGCTTAGTTT 0: 1
1: 0
2: 6
3: 30
4: 319
Right 1030333163 7:108294838-108294860 TCCTGCCCCGCAGCCATCTCTGG 0: 1
1: 0
2: 2
3: 25
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030333162 Original CRISPR AAACTAAGCATGTCCAAAAA AGG (reversed) Intronic
901009162 1:6189130-6189152 AGACTCACCATCTCCAAAAAAGG + Intronic
903618068 1:24676681-24676703 AAAATTAACATGTCCAAAATAGG + Intergenic
904060196 1:27703243-27703265 AAAATAAGAATGTTCACAAAAGG - Intergenic
905272400 1:36795739-36795761 AAATTCTGCATGTCCACAAAGGG + Exonic
905723406 1:40227611-40227633 CAAATAAGCATGATCAAAAATGG - Intronic
906825829 1:48978710-48978732 ACACTAAGCATTTCAACAAAAGG - Intronic
906916753 1:50020525-50020547 AAACTAAGCATATTCTAACAAGG - Intronic
908112166 1:60908626-60908648 AAAGTACACATGACCAAAAAAGG - Intronic
908419913 1:63949733-63949755 AACTTAAGCATGTCTGAAAATGG - Intronic
908584484 1:65553619-65553641 AAGCTAAGAATGTTGAAAAAAGG - Intronic
909174680 1:72341688-72341710 ATCCTAATCATTTCCAAAAAAGG - Intergenic
909328183 1:74379526-74379548 AAACTGAGCATGTCAGAAATGGG - Intronic
910004154 1:82374656-82374678 AAACTAAGGTTTTCCAAAGAAGG + Intergenic
911438821 1:97898996-97899018 ACACTAAGCATTCCCAAGAAAGG + Intronic
911588157 1:99714827-99714849 AGACTTAACATGTCCAAAATGGG - Intronic
911791175 1:102016910-102016932 AAAATTACTATGTCCAAAAAGGG + Intergenic
915384631 1:155478758-155478780 AAACTAAGGCTGTGCATAAAAGG + Exonic
915746662 1:158165613-158165635 GAACTGGGCATGTGCAAAAATGG + Intergenic
916916240 1:169409126-169409148 AAGCTAAGAATCTTCAAAAAAGG + Intronic
917177238 1:172249396-172249418 AAACAGATCAGGTCCAAAAAGGG - Intronic
918061290 1:181063549-181063571 AAAATTAGCAAGTACAAAAATGG + Intergenic
918456878 1:184729669-184729691 ATACTAAGCATGTATAAGAAAGG + Intronic
920145573 1:203858462-203858484 AAATTATGCATGACTAAAAAGGG - Intergenic
920415468 1:205796476-205796498 AAACTGGGCATGTGCAAAATGGG - Intronic
921595217 1:217047304-217047326 AAATTTGGCATGTCCAAAACTGG + Intronic
922353045 1:224750455-224750477 CTCCCAAGCATGTCCAAAAATGG - Intergenic
923657799 1:235933337-235933359 TAACTAAGAATTTCCAAGAATGG + Intergenic
1064549990 10:16490603-16490625 AAACCAAGCATTTCAAAATAGGG + Intronic
1064841316 10:19595643-19595665 AAAATTAGCATGACCACAAACGG - Intronic
1065811958 10:29450665-29450687 AAACTAATCATGTCCAAAGGAGG - Intergenic
1066678919 10:37917379-37917401 ATCCAAAGCATGTCCAGAAAAGG + Intergenic
1067395266 10:45910022-45910044 AAATTAACCATGTCTATAAAGGG + Intergenic
1067863588 10:49879146-49879168 AAATTAACCATGTCTATAAAGGG + Intronic
1069409510 10:68138922-68138944 GAACTAAGCATGTAAAAAAATGG - Intronic
1069649564 10:70035532-70035554 AAAATAAGCATGTGTAAATAAGG + Intergenic
1071028984 10:81150167-81150189 ATACGTAGCATGTCAAAAAAAGG + Intergenic
1071520277 10:86327193-86327215 AATGTAAGGATGTCCAACAAAGG - Intronic
1071865043 10:89720399-89720421 AAACTTAGCATCTCTAAGAATGG - Intronic
1071892442 10:90025429-90025451 AAACTAAAATTGGCCAAAAAAGG + Intergenic
1072034422 10:91551416-91551438 AAACACAGCATGGCCAAACATGG + Intergenic
1072603474 10:96955298-96955320 AAACTCTGCCTTTCCAAAAATGG + Exonic
1075889803 10:125937928-125937950 AAACTAAACATTTACAAAGACGG + Intronic
1077520177 11:3028499-3028521 AAAGTAAGCATTTTCAGAAATGG - Intronic
1078181243 11:9013185-9013207 AAAATTAGCATGTCCAATAAAGG - Intergenic
1078759974 11:14243965-14243987 AAACTCATCATGTCCAAAATGGG + Intronic
1079870223 11:25788830-25788852 CAAGTCAGAATGTCCAAAAAAGG - Intergenic
1081638809 11:44739018-44739040 AAACAAACCAGCTCCAAAAAGGG - Intronic
1081717819 11:45263362-45263384 AAATTAATCATGTCACAAAAGGG - Intronic
1085057763 11:73417137-73417159 CAACAAACCATCTCCAAAAATGG - Intronic
1085823838 11:79821628-79821650 AAAATAAGCATGTTGTAAAATGG + Intergenic
1086232380 11:84585693-84585715 AAACTAAATATATGCAAAAAAGG - Intronic
1086314562 11:85577523-85577545 AAACTTATCATGGCCAAAACTGG - Intronic
1086807396 11:91261585-91261607 TAAATAAGTATCTCCAAAAAAGG - Intergenic
1086980644 11:93194566-93194588 AAAAAAAGAATTTCCAAAAATGG - Intronic
1088067222 11:105734177-105734199 AAACTAAGTATGTATAAAATTGG + Intronic
1088487726 11:110356828-110356850 TAACTAAGCTTATCCACAAATGG + Intergenic
1088611288 11:111579833-111579855 ACTCTAATCTTGTCCAAAAAGGG + Intergenic
1090452792 11:126821398-126821420 AAAGCAAGAATATCCAAAAATGG - Intronic
1090551029 11:127820100-127820122 AAAAGACGCATGTCCAATAAGGG - Intergenic
1090556478 11:127882191-127882213 AAACTCAGCATGAAAAAAAATGG + Intergenic
1090913704 11:131144023-131144045 ATACTCAGCATATCTAAAAACGG - Intergenic
1091066565 11:132519065-132519087 AAACTATGCATGTCAGAAATGGG - Intronic
1091553157 12:1552172-1552194 AAAGTCAGCAGGTCCAAAAATGG - Intronic
1091974858 12:4816117-4816139 AAGCTTAGCATGTCTAAAAATGG + Intronic
1092801848 12:12176241-12176263 AAACTAGGTTTGTCCACAAAAGG + Intronic
1094561653 12:31560194-31560216 AAACTCAGAATGTCCAAAAATGG + Intronic
1094731365 12:33179896-33179918 TATCTGAGTATGTCCAAAAAAGG + Intergenic
1095747264 12:45673678-45673700 AAATTAAGCAAGTCCAGAAAAGG - Intergenic
1096293410 12:50361927-50361949 AAACTAAGAATATCAAAAAAGGG - Intronic
1097535491 12:60864950-60864972 ATACTAAGTATGTCTAAATAAGG - Intergenic
1097553454 12:61105641-61105663 AAACAAAACATGTTCAGAAATGG - Intergenic
1097708409 12:62892854-62892876 AAAAAAATCATTTCCAAAAATGG + Intronic
1097770683 12:63581163-63581185 CTACTAACCATGTCCACAAAAGG - Intronic
1098020972 12:66156251-66156273 AAACTTAACATGGCCAAAACTGG + Intronic
1098094802 12:66943783-66943805 TAACTAAGAATGTACTAAAACGG + Intergenic
1098611054 12:72458649-72458671 AAACTCAGTATGTCCAAAGCAGG + Intronic
1098674946 12:73277982-73278004 AATCTTAGAGTGTCCAAAAAAGG - Intergenic
1100238862 12:92689674-92689696 AAACTAAGCATGTTTTAAATTGG + Intergenic
1100650954 12:96587532-96587554 GATATAAGCATGTTCAAAAATGG - Intronic
1101458889 12:104868733-104868755 AAACTTAGTATATCCATAAATGG + Intronic
1101486489 12:105168075-105168097 AAATCAAGCATTTCCCAAAATGG - Exonic
1101521082 12:105483030-105483052 AAACTATGCATGTCACAAACAGG - Intergenic
1104141874 12:125995220-125995242 AACCTAAGCATGTGAACAAATGG + Intergenic
1106674168 13:31940111-31940133 AAACTCAGCATGTATAAAACTGG - Intergenic
1106741932 13:32653557-32653579 AAAACAAGCATGCCCAAAACAGG - Intronic
1108127800 13:47263356-47263378 ATATTAGGCTTGTCCAAAAATGG - Intergenic
1109685611 13:65815610-65815632 AAACAAAGCATCTATAAAAAGGG - Intergenic
1110089515 13:71427662-71427684 AAAATAAGAATGTTTAAAAATGG + Intergenic
1110862701 13:80360280-80360302 AAACCAAGCATGTCAAAATTTGG + Intergenic
1111534730 13:89588443-89588465 AAACCAAATATGTCTAAAAATGG + Intergenic
1112315479 13:98358418-98358440 ATACAAAGCAACTCCAAAAATGG - Intronic
1115387189 14:32811285-32811307 AAATTAAGAATGACCAAAAATGG - Intronic
1116119087 14:40698399-40698421 AATCTGAGCATGTTCAAATAAGG - Intergenic
1116655145 14:47643380-47643402 TACATATGCATGTCCAAAAATGG - Intronic
1117187117 14:53251296-53251318 AAACTTAGTATGTCCAAAGCTGG + Intergenic
1118541336 14:66829527-66829549 AAGCAATGTATGTCCAAAAAAGG + Intronic
1118681903 14:68250593-68250615 AAAAGAAGCATATCCAAAATAGG + Intronic
1122132904 14:99615934-99615956 AAACCAAGCAAGTCAAAACAAGG + Intergenic
1122395294 14:101423978-101424000 AAAAGAAGCAAGACCAAAAAAGG + Intergenic
1126950098 15:53871276-53871298 AACATAAGCATGGCTAAAAATGG - Intergenic
1129112925 15:73348492-73348514 AAAGTATGCATGTGTAAAAATGG - Intronic
1129550955 15:76448475-76448497 AAACTTAGCATGCCCAGAACTGG - Intronic
1129605618 15:77023642-77023664 AAATTCAGCGTGTCCAAAACCGG - Intronic
1130720398 15:86380708-86380730 AAGCCAAGCATGTGCATAAATGG - Intronic
1131340157 15:91591407-91591429 AAACTAACCATATCAAAAGATGG - Intergenic
1131710962 15:95055879-95055901 AAACTAATGATGATCAAAAAAGG - Intergenic
1132179292 15:99740065-99740087 AAACTAAAAATGTCCAAGAGTGG + Intergenic
1132416593 15:101624608-101624630 AAACCAAGCTTGTCCAACCATGG - Intronic
1134101811 16:11457894-11457916 AAAATAAGCCAGTCAAAAAAAGG + Intronic
1135321433 16:21500364-21500386 AAACTAAGCATGTCAATCATAGG + Intergenic
1135374267 16:21931860-21931882 AAACTAAGCATGTCAATCATAGG + Intergenic
1135437519 16:22438854-22438876 AAACTAAGCATGTCAATCATAGG - Intergenic
1135819060 16:25664324-25664346 CAAGTAAGTATGTCCAATAAAGG - Intergenic
1136332910 16:29593478-29593500 AAACTAAGCATGTCAATCATAGG + Intergenic
1136447605 16:30333567-30333589 AAACTAAGCATGTCAATCATAGG + Intergenic
1136775037 16:32867372-32867394 AGACTCAGCTTGTCCAAAATGGG - Intergenic
1136895581 16:33994140-33994162 AGACTCAGCTTGTCCAAAATGGG + Intergenic
1140930910 16:79626973-79626995 AAACTTAGAAAGTACAAAAAAGG + Intergenic
1203077455 16_KI270728v1_random:1129481-1129503 AGACTCAGCTTGTCCAAAATGGG - Intergenic
1142765980 17:2064633-2064655 AAGGTAAGCATGGCCAAGAAAGG + Intronic
1143963008 17:10736132-10736154 AAACTAAGAATTTCCATAAAGGG - Intergenic
1144330205 17:14216364-14216386 AAATTTAGCTTGTCAAAAAAGGG + Intergenic
1144528086 17:16008279-16008301 ATACTTAACATGTCCAAAATAGG + Intronic
1145851199 17:28098989-28099011 AAAATAAGCCTGTACAAGAATGG - Intronic
1146800647 17:35817371-35817393 AAACTAATCAGGTCCAAAAAGGG - Intronic
1146893400 17:36523478-36523500 AAACTAAACAAGTGAAAAAATGG + Intronic
1149055444 17:52357759-52357781 TAACTAAGTATGTTCAGAAAGGG + Intergenic
1150551883 17:66218253-66218275 AAACTAAGCATGGCCAGTGATGG + Intronic
1150667694 17:67158012-67158034 AAACTAAACATGATCTAAAATGG + Intronic
1150904320 17:69321356-69321378 AAATGAGGCATGACCAAAAAGGG + Intronic
1152910012 17:82998283-82998305 TAAAAAAGCATGTCCATAAAAGG + Intronic
1153266199 18:3272164-3272186 AGACTAGTCATGTTCAAAAAAGG - Intronic
1155088779 18:22485479-22485501 CAAATCAGCATGCCCAAAAATGG - Intergenic
1155133523 18:22963425-22963447 ACACTAAGCATATGAAAAAAAGG - Intronic
1155850329 18:30766599-30766621 AAACTAAACATGTCCTGAGAAGG - Intergenic
1156330732 18:36119253-36119275 AAACTCAGCATATTCCAAAAAGG + Intronic
1157186530 18:45545162-45545184 AAACAAAGCATGTCCGCAGATGG - Intronic
1157367577 18:47079909-47079931 AATCTTAGCATCACCAAAAATGG - Intronic
1158383195 18:56958743-56958765 AAACAAAAACTGTCCAAAAATGG - Intronic
1158607139 18:58905755-58905777 AAACTAAGGAAATCCAAATAAGG - Intronic
1159382117 18:67674110-67674132 AAACTTAACATGTCCCAAACTGG + Intergenic
1159660267 18:71087539-71087561 ATATTGAGCAAGTCCAAAAATGG + Intergenic
1159747955 18:72262949-72262971 AAACAATGCATGTCAAATAATGG + Intergenic
1160319231 18:77874885-77874907 AAATTAAGCAAGTTCAACAATGG + Intergenic
1163065717 19:14792911-14792933 AAAAAAAGCTAGTCCAAAAAAGG - Intronic
1164217585 19:23163320-23163342 AAACAAAGAATGTGTAAAAAGGG + Intergenic
1165505584 19:36226599-36226621 AAAGGAAGCATGTCCACAACTGG - Intronic
1167975150 19:53220527-53220549 TATCTAAACATGTCCAAACATGG - Intergenic
925507115 2:4579523-4579545 AAAGCAGGCATGTGCAAAAAAGG + Intergenic
926390788 2:12390462-12390484 AAACTCAGAATTTCCAAAACTGG - Intergenic
928943958 2:36755501-36755523 AAACTTAGCATCACCAACAATGG - Intronic
929112614 2:38418105-38418127 AAACTAGGAATGTGAAAAAAAGG + Intergenic
929408840 2:41673518-41673540 AAACTATGCATGTCAAACTAAGG + Intergenic
929477991 2:42272090-42272112 AAAAAAACCCTGTCCAAAAATGG + Intronic
929854509 2:45625354-45625376 AACCTAAGTATGTCCCAAGAAGG + Intergenic
930732853 2:54744746-54744768 AAACTCAGCATGTCTGAAATAGG - Intronic
930793936 2:55367763-55367785 AAACTAACCAAGTTCAAAACTGG + Intronic
931467414 2:62503195-62503217 AAACTAATCTTATACAAAAACGG + Intronic
933136705 2:78745105-78745127 AAATAAAGCATGAACAAAAAAGG - Intergenic
934475565 2:94591254-94591276 ACACTCAACATGTCCAGAAAGGG + Intronic
934953525 2:98596379-98596401 AAATTAAGAATGCCAAAAAATGG + Intergenic
936341410 2:111636461-111636483 ACACAAAACCTGTCCAAAAATGG + Intergenic
938453108 2:131441520-131441542 AAACTTAATATGTCCAAAATGGG - Intergenic
939761087 2:146180586-146180608 AAACTTAGCATCACCAATAATGG + Intergenic
940862100 2:158781317-158781339 AAAATAGGCATGCCAAAAAAAGG - Intergenic
941505372 2:166337325-166337347 AAACACAGGATGTCCAAAATTGG - Intronic
943200760 2:184820587-184820609 AAATAAAGCATGTTCAAATAGGG + Intronic
943748085 2:191483187-191483209 TATCTAAGTATATCCAAAAAAGG - Intergenic
944934577 2:204554405-204554427 AATCTAAGCATGTCATTAAATGG + Intronic
947212410 2:227720197-227720219 AAAATAAACATATACAAAAATGG - Intergenic
947679227 2:232014591-232014613 CAACTAAACATCTCCACAAATGG - Intronic
947862269 2:233369029-233369051 AACCTAAGCCAATCCAAAAAAGG - Intronic
949054172 2:241916057-241916079 AAACTAAGAATGACAATAAAAGG + Intergenic
1169501037 20:6161044-6161066 AAAAAAAACATGTCCAAAAGGGG - Intergenic
1169799164 20:9497450-9497472 TAACTAAACATGTCCACAATGGG - Intergenic
1169887929 20:10422349-10422371 AACATAAGCATGTCAATAAAAGG - Intronic
1170426803 20:16243243-16243265 AAACTCAGCGTTTCCAAACATGG - Intergenic
1170432780 20:16292223-16292245 AAAATAAGTATATCTAAAAATGG + Intronic
1172793518 20:37522145-37522167 AAAAAAAGCACTTCCAAAAAAGG + Intronic
1172886717 20:38236244-38236266 TAACTTAGCATGCCCAAATATGG - Intronic
1174907797 20:54571046-54571068 CAATTAAGAATTTCCAAAAATGG - Intronic
1178114862 21:29406623-29406645 ACACTAAACATGTGCATAAAAGG - Intronic
1178564623 21:33671886-33671908 AAACTACAAATGTACAAAAAAGG - Intronic
1181271142 22:21659184-21659206 AAAGTAAACATGTACAAAACTGG + Intronic
1183137535 22:35903603-35903625 AAACTCAACATGCCCAAAATTGG + Intronic
1184023938 22:41839933-41839955 AAACTAAGCATGTGAATAAATGG - Intronic
949465187 3:4336417-4336439 AAAGTAAGCATGTGAAAAGAGGG + Intronic
949565469 3:5240788-5240810 AAACCCAGCATTTCCAAAGATGG + Intergenic
949705031 3:6806550-6806572 ATACTAACCATGACCATAAAAGG - Intronic
950970695 3:17184043-17184065 AAACAAAGGCTGTCCATAAATGG + Intronic
951419428 3:22466805-22466827 AGACTTAGGATGTCCAGAAAAGG + Intergenic
951713462 3:25611050-25611072 AAACTCAGCATGTCTGAAACTGG - Intronic
952158933 3:30673870-30673892 AAACAAAGCATGCCAAAATAAGG - Intronic
953265580 3:41384128-41384150 AAACTTAGCATCACTAAAAATGG + Intronic
953432259 3:42850024-42850046 AAAATAAGGATGTACAAAAGGGG + Intronic
954658486 3:52212850-52212872 TAACTAAGCATGCCCTCAAATGG + Intronic
955345086 3:58154961-58154983 AACCTAATCATGTTCAAACAAGG - Intronic
956050878 3:65246962-65246984 AAGCAAAGCATGACCTAAAAGGG - Intergenic
956800082 3:72749463-72749485 AAAATATGCCTGACCAAAAAAGG + Exonic
957472085 3:80670841-80670863 AAATAAATCAAGTCCAAAAAAGG + Intergenic
957931522 3:86884564-86884586 AAACTTAGCATGTCCAAATCTGG - Intergenic
958456046 3:94332621-94332643 AAAGTAAGCATCACCAATAATGG - Intergenic
961395252 3:126582712-126582734 AAATTAAACCTGTCCAAAAACGG + Intronic
961855553 3:129867194-129867216 AAACTAAGCTTGTCTCCAAAAGG + Intronic
963682910 3:148403151-148403173 AAACTTAGCATCTCCAAGTACGG + Intergenic
964055159 3:152446511-152446533 AGACTAAGCATGCACAATAAAGG - Intronic
965218366 3:165894227-165894249 AAACTCAGTATGTCCAAAATCGG + Intergenic
965781136 3:172287288-172287310 AAACTCAGCATGTCCAAGAATGG - Intronic
965863330 3:173173483-173173505 AAAATAAGCATTTGCAAAAATGG - Intergenic
966257685 3:177936487-177936509 AAAATAATCATTTCCATAAAAGG - Intergenic
970430626 4:15985918-15985940 AAAGTAAGCGTGTCCATAAGTGG - Intronic
970638912 4:18041546-18041568 AAACAAGTCCTGTCCAAAAAGGG + Intergenic
970953114 4:21779600-21779622 AAAATAAGAATATACAAAAATGG + Intronic
971902494 4:32680122-32680144 AAAAAATGCATGTTCAAAAAAGG - Intergenic
972082083 4:35165379-35165401 AAAACTAGCAAGTCCAAAAAAGG - Intergenic
972208887 4:36813105-36813127 AACCAATGCATGTCAAAAAAAGG + Intergenic
974147900 4:57968689-57968711 AATCTAAGTGTGTCCAAAATTGG - Intergenic
975637699 4:76466790-76466812 AAATTAAACATGTACAAAAAAGG - Intronic
976065694 4:81184728-81184750 AAACTAAGAATGTTGAAAAAGGG + Intronic
976291585 4:83423944-83423966 AAATCAAGAATGTTCAAAAAAGG + Intronic
976417738 4:84798351-84798373 AAACCAAACATTTTCAAAAAAGG + Intronic
976659883 4:87529546-87529568 AAAATAAAAATCTCCAAAAAAGG - Intronic
977408712 4:96633940-96633962 AAACTCAGCATGTTCACTAATGG - Intergenic
978157254 4:105504199-105504221 AAACTCATCAGCTCCAAAAAAGG - Intergenic
978595807 4:110375733-110375755 AAACTTAGTATGTCCAAAGCTGG - Intronic
979812994 4:125063850-125063872 AAATTAACCTTGACCAAAAAGGG + Intergenic
979902270 4:126236553-126236575 AAACTAAACACGTCCCAAGAGGG - Intergenic
980165458 4:129220890-129220912 AAGCTAAACATGTCCCAAATTGG + Intergenic
980399908 4:132269294-132269316 ACACTATGTATCTCCAAAAAAGG + Intergenic
980966653 4:139527931-139527953 AAAGGAAGCTTGTCCAAAAGTGG - Intronic
981021699 4:140035998-140036020 AAACAAAGCATATCCACGAAAGG + Intronic
981337529 4:143583704-143583726 AAACTAAGCTTCATCAAAAAAGG + Intronic
981991184 4:150922785-150922807 AAAATAAACATTTCAAAAAATGG + Intronic
984804799 4:183741855-183741877 AAACAAAGCAAAACCAAAAATGG - Intergenic
987746852 5:21985729-21985751 AAACTAGGCAACTTCAAAAAAGG - Intronic
988783845 5:34547902-34547924 TATCTGAGTATGTCCAAAAAAGG + Intergenic
989271432 5:39538073-39538095 AAACTTAACATGTCCCAAATTGG - Intergenic
990054682 5:51557817-51557839 AATCTAAGCATGTGATAAAATGG + Intergenic
990729228 5:58790134-58790156 AAACTCAGCATGTCCAAAATAGG + Intronic
991767025 5:69995490-69995512 AAACTAGGCAACTTCAAAAAAGG - Intergenic
991846257 5:70870567-70870589 AAACTAGGCAACTTCAAAAAAGG - Intergenic
992810583 5:80383898-80383920 AAACTCAACATCTCCAAATATGG + Intergenic
994068572 5:95572006-95572028 AATATAAGCAGGTTCAAAAATGG - Intronic
996940532 5:128999934-128999956 GTTCCAAGCATGTCCAAAAATGG + Intronic
996990060 5:129618788-129618810 AGGCTATGCATGTACAAAAATGG + Intronic
997409255 5:133678598-133678620 AAAATGAGCATGTCCAAAACTGG - Intergenic
997693981 5:135847014-135847036 AATCTAAGCAAGTCTTAAAATGG + Intronic
997970966 5:138401483-138401505 AAATGAAGTATATCCAAAAAAGG - Intronic
998667095 5:144309771-144309793 CAACTAATAATGTCCCAAAATGG - Intronic
998939317 5:147263342-147263364 ATACTCAGAATGTCCAAACAGGG + Intronic
999613656 5:153398729-153398751 AGGATAGGCATGTCCAAAAAAGG + Intergenic
1002056626 5:176601572-176601594 AAACTCAGCTTGTCCAAAAACGG - Intronic
1004294147 6:14394914-14394936 AAATTAATCAAATCCAAAAAGGG + Intergenic
1004540257 6:16543088-16543110 AATCACAGCATGTCCACAAATGG + Intronic
1004767833 6:18751133-18751155 AAACGGAGCATGTAGAAAAATGG - Intergenic
1005116082 6:22339146-22339168 AAAATAATACTGTCCAAAAAGGG - Intergenic
1007205813 6:40149653-40149675 AAACTAAGCAAGTTGAAGAAAGG - Intergenic
1008172159 6:48221465-48221487 AAAATAAGCATTTGCAGAAAGGG - Intergenic
1008313891 6:50014992-50015014 AAACTCTACATGTCCAAAATTGG + Intronic
1008799728 6:55351793-55351815 AAAATCAGCATGTCAAAATATGG + Intronic
1009279304 6:61726443-61726465 AAACAAAGCATATTCAAATAGGG + Intronic
1009589021 6:65642133-65642155 AATAAAAGCATGGCCAAAAAAGG + Intronic
1010042530 6:71402748-71402770 AAAATACGCATTTACAAAAAAGG + Intergenic
1010771904 6:79841394-79841416 ACACTCAGCATGTCTAAAGATGG - Intergenic
1010898972 6:81402227-81402249 AAAATAAGCATTGCCAAAAAGGG + Intergenic
1011003758 6:82621058-82621080 AAAATAAGCATATAAAAAAATGG + Intergenic
1011963312 6:93119701-93119723 AAAATTAACATGTCCAATAATGG - Intergenic
1011980660 6:93372378-93372400 AAAATAATCATGTTGAAAAATGG - Intronic
1012109259 6:95205536-95205558 AAACTTAAAATGTCCAAAAAAGG - Intergenic
1013480227 6:110546646-110546668 AAACTCAGTATGTTCAAAAGTGG + Intergenic
1014880455 6:126717573-126717595 ATAATTAGCTTGTCCAAAAATGG - Intergenic
1014984810 6:127991475-127991497 AAACTAAGTAATTCCAAAAAAGG + Intronic
1015018447 6:128442690-128442712 AAACTAAACTTGTGCAAAAATGG + Intronic
1017258302 6:152359732-152359754 AAACTGATTATGTCCAGAAATGG + Intronic
1018197303 6:161366511-161366533 AAACTAAGTATGGCCTAAGAAGG + Intronic
1020370167 7:7423312-7423334 AAATTAAGCATGCACAAAAGTGG - Intronic
1021928015 7:25551984-25552006 AAACCAAGCATATCCTAATAAGG - Intergenic
1022435752 7:30383186-30383208 ATATTAAACATGTCAAAAAAAGG - Intronic
1022930164 7:35103418-35103440 CTACTAACCATGTCCACAAAAGG - Intergenic
1023682780 7:42704808-42704830 AAAGTAAGCTTGTACCAAAAAGG + Intergenic
1023780394 7:43650073-43650095 ACAGGAAGCATGTCCAGAAATGG + Exonic
1024140824 7:46461610-46461632 TATCTGAGCATGTCCATAAAAGG + Intergenic
1026379261 7:69782830-69782852 CAACAAAGCCTTTCCAAAAAGGG - Intronic
1027793804 7:82666448-82666470 AAACTAAGCATAGCAAAAAACGG + Intergenic
1028772858 7:94647165-94647187 AAACTAAGCTTGTCCAAACTAGG + Intronic
1028819153 7:95185874-95185896 AAAATAGGCATGTAGAAAAAAGG - Intronic
1029826052 7:103195941-103195963 CTACTAACCATGTCCACAAAAGG - Intergenic
1030333162 7:108294810-108294832 AAACTAAGCATGTCCAAAAAAGG - Intronic
1030703250 7:112663841-112663863 AAAGTAAGCAAGTTCCAAAATGG + Intergenic
1031588017 7:123556238-123556260 AAACTTAACATGTCCAAAATGGG - Intronic
1032554095 7:132813388-132813410 AAAATATGCATATCCAAAACGGG + Intronic
1032858154 7:135854095-135854117 AAACTAAGCAAACCCAAGAAGGG - Intergenic
1032870468 7:135979149-135979171 AAACTTAACATGTCCAGAATAGG + Intergenic
1032913652 7:136462527-136462549 GAACTCATCATGTCCCAAAAGGG + Intergenic
1033186870 7:139234729-139234751 CAATTAAGCATGTTCACAAATGG - Intronic
1034839165 7:154379825-154379847 AAACTAAGCATTGCCAATATTGG + Intronic
1036798281 8:11771311-11771333 AGAGCAAGCATGGCCAAAAAGGG - Intronic
1037086098 8:14852670-14852692 AAACTAAATATGAACAAAAATGG - Intronic
1039916283 8:41862685-41862707 AAACTAAACAAGTTCAAAAGGGG + Intronic
1041226663 8:55707024-55707046 AAACAAAGAATGTGTAAAAAGGG - Intronic
1042048333 8:64680245-64680267 AAAGTAAGCATGTGCAACACTGG - Intronic
1042757438 8:72231786-72231808 AAACTAAGCATAATTAAAAATGG + Intergenic
1043679380 8:83002753-83002775 AAACTAATCAAACCCAAAAAGGG + Intergenic
1043973623 8:86561141-86561163 AAAAAAAGTATGTCCAAATATGG - Exonic
1044278194 8:90326415-90326437 AAACTCAACATGTCTAAAAATGG + Intergenic
1046038752 8:108876701-108876723 AAACTAAACATGGCCAGAGAAGG + Intergenic
1046254939 8:111683681-111683703 AAACTAAGCTTGTCTTTAAATGG - Intergenic
1046315842 8:112500794-112500816 GGACTAGGCATGTCCAAAATGGG + Intronic
1046875229 8:119247547-119247569 AAACTATGTATGCTCAAAAATGG - Intergenic
1047126010 8:121961534-121961556 AAAATTGGCATGTCCACAAAAGG + Intergenic
1048009109 8:130442844-130442866 AAACGCAGCAGGTCCCAAAATGG + Intronic
1048866924 8:138768169-138768191 AAAGGAAGGATGTCCAGAAATGG - Intronic
1051867993 9:21703592-21703614 AAACTACGTATTTGCAAAAATGG - Intergenic
1052419991 9:28231816-28231838 GCACTAAGCATGCACAAAAATGG + Intronic
1053223087 9:36327583-36327605 AAACTCAACATATCCAAATATGG - Intergenic
1053596853 9:39571687-39571709 AAAAAATGCATGTCCAAAAATGG + Intergenic
1053682501 9:40494824-40494846 ACACTCAACATGTCCAGAAAGGG - Intergenic
1053854825 9:42328335-42328357 AAAAAATGCATGTTCAAAAATGG + Intergenic
1053932484 9:43123150-43123172 ACACTCAACATGTCCAGAAAGGG - Intergenic
1054281213 9:63130105-63130127 ACACTCAACATGTCCAGAAAGGG + Intergenic
1054295600 9:63330324-63330346 ACACTCAACATGTCCAGAAAGGG - Intergenic
1054393621 9:64634828-64634850 ACACTCAACATGTCCAGAAAGGG - Intergenic
1054428269 9:65140041-65140063 ACACTCAACATGTCCAGAAAGGG - Intergenic
1054502110 9:65881502-65881524 ACACTCAACATGTCCAGAAAGGG + Intronic
1054569400 9:66793312-66793334 AAAAAATGCATGTCCAAAAATGG - Intergenic
1054726719 9:68659627-68659649 AAAATAAACATGTCAGAAAATGG + Intergenic
1055620765 9:78122671-78122693 AAACTTAACATGTCCAAAAATGG + Intergenic
1058006700 9:99923766-99923788 AAATTAATCAAGCCCAAAAAGGG - Intronic
1059885476 9:118740414-118740436 AAAGCATGCATGTCCAAAGAGGG - Intergenic
1059976621 9:119724694-119724716 AAACTCAGCATGTCCCAAAGTGG + Intergenic
1186004393 X:5052041-5052063 ATCCAAAGCATGTTCAAAAAAGG + Intergenic
1186998296 X:15148110-15148132 AAACTAATTATGTGCAAACAAGG + Intergenic
1188145780 X:26611472-26611494 AAAATAAGAATGTAAAAAAATGG - Intergenic
1189464210 X:41266011-41266033 TAAATATGCATGTCTAAAAACGG - Intergenic
1190119005 X:47645173-47645195 AAACTGACCATCTCCAAAACTGG - Intronic
1191690636 X:63934472-63934494 AAATTAGGCAAGTCCACAAACGG + Intergenic
1191934144 X:66408193-66408215 AAACTATGAATCTCCACAAAGGG - Intergenic
1192316809 X:70058740-70058762 AAACTAAACATATCAAAACATGG + Intergenic
1192903709 X:75526579-75526601 AAAGCAAGCATCTCAAAAAAAGG - Intergenic
1193394389 X:80967398-80967420 AAACTAAGAACGTTGAAAAAAGG - Intergenic
1193511979 X:82413510-82413532 GAACACAGCATGTCCAAAAATGG - Intergenic
1194058888 X:89172339-89172361 AAACAAAGCAGGTGGAAAAAAGG + Intergenic
1194295398 X:92120769-92120791 AGACTAAACATGTTCAAATAAGG - Intronic
1194358894 X:92922509-92922531 AAACAAAGAAGGTCCAAATAAGG - Intergenic
1194430130 X:93793163-93793185 AAATTAAGCATCACCAATAATGG - Intergenic
1194631445 X:96290451-96290473 ACACTATGCATATCCAAACAAGG + Intergenic
1195264058 X:103163001-103163023 AATCTGAGCATATCCCAAAAAGG - Intergenic
1195485337 X:105398208-105398230 GAACTGAGCAGGTACAAAAATGG - Intronic
1195810488 X:108824123-108824145 AAGCTAAGAATGTTGAAAAACGG - Intergenic
1196821593 X:119705587-119705609 AAACTCAACATGTCCCAAACTGG - Intergenic
1198895263 X:141447293-141447315 AAACTAAATATGTCCTGAAAAGG + Intergenic
1199535989 X:148903866-148903888 AACCCAAGCAGGTCCAAACACGG + Intronic
1200104902 X:153706688-153706710 AGACTCAGCTTGTCCAAAACGGG + Intronic
1200373140 X:155749117-155749139 AAAATAAGCTTTTACAAAAAAGG + Intergenic
1200612901 Y:5345277-5345299 AGACTAAACATGTTCAAATAAGG - Intronic
1200667110 Y:6038522-6038544 AAACAAAGAAGGTCCAAATAAGG - Intergenic