ID: 1030335629

View in Genome Browser
Species Human (GRCh38)
Location 7:108322944-108322966
Sequence TCCTCTCTGTGTACAAAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030335626_1030335629 1 Left 1030335626 7:108322920-108322942 CCAAGTGACATTAAGCAAATTAC 0: 1
1: 0
2: 6
3: 57
4: 369
Right 1030335629 7:108322944-108322966 TCCTCTCTGTGTACAAAATGGGG 0: 1
1: 0
2: 0
3: 13
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030335629 Original CRISPR TCCTCTCTGTGTACAAAATG GGG Intronic
902524383 1:17046238-17046260 TCATGTCAGTTTACAAAATGGGG - Intronic
902862417 1:19255985-19256007 TCTTCTCTGTGGCCAACATGAGG + Exonic
906774984 1:48521127-48521149 TCATTTCTGTGTACAAATGGGGG - Intergenic
908647413 1:66293544-66293566 TCCTCCGTGTCTGCAAAATGGGG + Intronic
910635844 1:89406445-89406467 TGGTCTCTGTGTCAAAAATGAGG + Intergenic
910658792 1:89647596-89647618 TACTCTCTGGGTACAATATACGG + Intronic
914999390 1:152574216-152574238 TCCTGTCTGAGGACAGAATGTGG + Intronic
916656210 1:166877559-166877581 TCCTCTCTGTGTCAAAACTCTGG + Intergenic
916901069 1:169224296-169224318 TCCTCTCTGTGCATAAGATCGGG + Intronic
920843439 1:209574241-209574263 TCCTCTCTCTCTACAACATTTGG - Intergenic
921035159 1:211370761-211370783 TCCTATGTGTGTACAATATAAGG - Intronic
1063086822 10:2827189-2827211 TCCACTGTGTGTATTAAATGAGG - Intergenic
1063522335 10:6752251-6752273 TCGTCTCAGTGTTCAGAATGAGG - Intergenic
1063981289 10:11453869-11453891 TCCTCTTTGTTTACTACATGTGG + Intergenic
1065765185 10:29022837-29022859 TGCTCTCTGTCTCCATAATGGGG + Intergenic
1066676780 10:37896321-37896343 CCCTATGTGTGTAAAAAATGTGG + Intergenic
1069315149 10:67089638-67089660 TCCTTTATGTGTGCCAAATGAGG - Intronic
1075400128 10:122155076-122155098 TGCTGTCTCTGTTCAAAATGAGG + Intronic
1075556862 10:123439193-123439215 TTCTCTTTGTCTACAGAATGAGG - Intergenic
1078452206 11:11448867-11448889 TCCTCTCTGTTTGCACACTGGGG - Exonic
1079363639 11:19790796-19790818 TCCTTTCTGTTTGCAAAAGGGGG + Intronic
1080816397 11:35761623-35761645 TCATCTCTGTTTTCCAAATGAGG + Intronic
1080974398 11:37319790-37319812 TGGTCTCTGTGTTCAAAATCAGG - Intergenic
1085076276 11:73595970-73595992 TCTTCTCTGTTTACATAAAGCGG + Intronic
1088593153 11:111420413-111420435 TGGTCTTTGTGTAAAAAATGTGG - Intronic
1090983906 11:131748968-131748990 TTTTCTGTGTGAACAAAATGAGG - Intronic
1093497081 12:19770357-19770379 TTTTCTGTGTGTAGAAAATGGGG + Intergenic
1096997404 12:55847430-55847452 CCCTCTCTGTCCACAAATTGTGG + Intergenic
1099923885 12:88993822-88993844 TCCTTCTTGTGTAGAAAATGAGG - Intergenic
1100556665 12:95701223-95701245 TCATCTCTCTGTTCAAAAAGTGG - Intronic
1108059655 13:46519758-46519780 TCATCCCTAAGTACAAAATGGGG + Intergenic
1108218796 13:48211966-48211988 ACATCTCTGTGTACATACTGTGG + Intergenic
1109861276 13:68201837-68201859 TGTTCTCTGTTTACAAAATGAGG + Intergenic
1109873983 13:68373936-68373958 TCCTATCTGTGTATAAACAGAGG + Intergenic
1110972135 13:81777445-81777467 TTCTGTCTCTGTACATAATGTGG + Intergenic
1112589838 13:100752790-100752812 TACTCTCTCTGTGCCAAATGAGG + Intergenic
1113354007 13:109560627-109560649 TCCTCTTTTTGTGCCAAATGGGG + Intergenic
1113629386 13:111871731-111871753 TCCATTCTGTCTACAGAATGTGG + Intergenic
1114267781 14:21082734-21082756 TCCTCTCTGTAGCCCAAATGAGG - Intronic
1114718010 14:24848818-24848840 ACCTCTCTGGGAACAACATGAGG + Intronic
1115227341 14:31117715-31117737 TCACCTATGTGTACAAAACGGGG + Intronic
1115404393 14:32998570-32998592 TCCCCCTTGTGTACAGAATGAGG + Intronic
1117794809 14:59381513-59381535 TACTCTCTATCTCCAAAATGTGG + Intergenic
1118105939 14:62659708-62659730 TCCACTCTTGTTACAAAATGTGG + Intergenic
1120006081 14:79359363-79359385 TTCCCTCTGGGTACAGAATGTGG + Intronic
1120470275 14:84914816-84914838 TACTCTCTCTGTAATAAATGAGG + Intergenic
1122170679 14:99872059-99872081 TCCTGTCTGTGTACTATTTGTGG + Intronic
1122243753 14:100386321-100386343 TCCTATCTGTTTACATAATTGGG + Intronic
1124376461 15:29132107-29132129 TCCTCTCTTTATCCAAACTGAGG + Intronic
1126810253 15:52395406-52395428 ACCTCTCTCTTTACAAGATGAGG + Intronic
1126890558 15:53199871-53199893 TCCTTCCTCTGTACAAAGTGAGG - Intergenic
1126903370 15:53337607-53337629 TTCTTTCTGTGTACACAAAGAGG - Intergenic
1127002270 15:54523154-54523176 TACTCTATGTGTCCAAATTGAGG - Intronic
1128906979 15:71476051-71476073 CCTTCTTTGTCTACAAAATGGGG + Intronic
1130286081 15:82555813-82555835 TCCTCTCTGCTCCCAAAATGAGG + Intronic
1131627648 15:94139417-94139439 TCTTCAATGTGTACATAATGGGG + Intergenic
1133288449 16:4702237-4702259 CCTGCTCTGTGTACAGAATGGGG + Exonic
1133763316 16:8817404-8817426 TCCTCTCTGTCTACAAGAAATGG - Intronic
1135925680 16:26691752-26691774 AGCTGTCTGTGTGCAAAATGAGG - Intergenic
1136924648 16:34360812-34360834 TCCTCCCTGTGACCAAAATTGGG - Intergenic
1136979925 16:35050994-35051016 TCCTCCCTGTGACCAAAATTGGG + Intergenic
1137394952 16:48110485-48110507 TCCTCTCTGTGTCCAGCATGGGG + Intronic
1140223543 16:73061064-73061086 TCCTCTCTGTGAGCCAAATCTGG + Intergenic
1140355496 16:74302435-74302457 TCCTCTCCATTTCCAAAATGTGG - Intronic
1141818932 16:86431957-86431979 TCCTCTCTCGGCACAGAATGTGG + Intergenic
1143581286 17:7828456-7828478 CCCTCTCTGTCTAAAAAAAGAGG - Intronic
1148749842 17:49939245-49939267 TCTTCTCTGTGGCCAACATGAGG + Intergenic
1148835800 17:50465168-50465190 TCCTCTCTCTGTAAAAATGGAGG + Intronic
1149353631 17:55817092-55817114 TTAACTCTGTCTACAAAATGTGG - Intronic
1151277287 17:73045055-73045077 TGCTGTCTGTGTAGCAAATGTGG - Intronic
1155091953 18:22520766-22520788 TCCTGTCTGTCTTGAAAATGGGG + Intergenic
1156566596 18:38198258-38198280 TCCTCTCTGTGCAAAAGAAGTGG - Intergenic
1158993943 18:62898026-62898048 TCTCCTCTTTGTACAAAGTGTGG + Intronic
1162829227 19:13274275-13274297 TCTTCTCTGGGAACACAATGAGG - Intronic
1163264382 19:16209692-16209714 TTCTGTCTGTCTACAGAATGAGG - Intronic
1166123282 19:40698800-40698822 ACCCCTCTGGGGACAAAATGGGG + Intronic
1166413988 19:42578681-42578703 ACCTCTTTGTATAAAAAATGTGG + Intergenic
1168541214 19:57212037-57212059 TCCTTTGTGTGCACAGAATGTGG + Exonic
925292602 2:2757606-2757628 TCCTCTCTGTGGACAAAACAGGG + Intergenic
925722543 2:6843003-6843025 TCCCCTCTGTGTCCCAACTGAGG - Intronic
926933509 2:18063768-18063790 TCCTCACTGTGTAGAAGATGGGG - Intronic
926995700 2:18733289-18733311 TCTTCTCTGTGTGCAGAGTGTGG - Intergenic
933194180 2:79370147-79370169 TTCTCTCTGTGTAGAGAATGTGG - Intronic
933219640 2:79673548-79673570 TCCTCTGTGAATACAAAATAAGG + Intronic
933353732 2:81189782-81189804 TTCTCTCTCTCTACCAAATGAGG - Intergenic
935914206 2:107931692-107931714 TTCTCTCTGTGTTCAAACTCAGG - Intergenic
937731669 2:125239505-125239527 TCATCTCTGTGTATTAAATCTGG - Intergenic
937808645 2:126174913-126174935 TTCTCTCTCTGTTCAACATGGGG + Intergenic
940162975 2:150733611-150733633 TTCTCTCGGTGTCCAAAATAAGG + Intergenic
941094843 2:161227291-161227313 TCCCCGCTGTGAACAAAACGAGG - Intronic
942427933 2:175879054-175879076 TCCTTTCTGTGGACCCAATGAGG - Intergenic
946270946 2:218594039-218594061 TCTTCCCTGTCCACAAAATGTGG + Intronic
948097882 2:235350841-235350863 TCCTACCTCTGTGCAAAATGTGG + Intergenic
948756351 2:240161718-240161740 TTTTCTCTGTGTCCAAAAAGGGG + Intergenic
1169899498 20:10538434-10538456 TCCTCCCTGTGTACAATGTCTGG - Intronic
1170713090 20:18809697-18809719 TCCTCATTGGGAACAAAATGTGG - Intergenic
1173081038 20:39867796-39867818 AGCTCTATGTCTACAAAATGGGG - Intergenic
1173969651 20:47142323-47142345 TCCTTTCTGTATACACAGTGTGG - Intronic
1173974301 20:47175441-47175463 TCCTCCTCGTGTGCAAAATGGGG + Intronic
1174538592 20:51271960-51271982 TCCTCTCTGAGACGAAAATGTGG + Intergenic
1175731696 20:61358616-61358638 CCCTCTCTGTGTAAAATACGGGG - Intronic
1177225579 21:18249774-18249796 TCTTATCTGTTTTCAAAATGAGG - Intronic
1178049654 21:28733649-28733671 TCCTGTGTGTGAAAAAAATGGGG - Intergenic
1179577361 21:42316463-42316485 TCCTGTTTGTGTTAAAAATGTGG - Intergenic
1179728406 21:43353757-43353779 TCCTCTCTGGGGAGAAAAAGGGG - Intergenic
949187885 3:1215890-1215912 TTCTCTCAGGCTACAAAATGTGG - Intronic
951194033 3:19804121-19804143 TCCTCTCTGTGCAGAGATTGTGG + Intergenic
951453946 3:22869941-22869963 TCCTCTATGACTACAAAATGAGG + Intergenic
951590903 3:24263335-24263357 TTATCTCTGTTTACCAAATGAGG + Intronic
952879650 3:37975550-37975572 TCCTCTCCGTGTACATAAGATGG - Intronic
952988272 3:38807539-38807561 TCCTCTCTCTGTTCCATATGAGG + Intergenic
957256985 3:77849964-77849986 TTATTTTTGTGTACAAAATGTGG + Intergenic
960071242 3:113433666-113433688 TCCTCTGTAAGTACAAAATGGGG + Exonic
961444893 3:126975760-126975782 CCCTCTCTGTCTACCATATGGGG - Intergenic
961618789 3:128206754-128206776 TCCTCTCTGTCTAACAGATGAGG + Intronic
962990719 3:140574788-140574810 TTCTCTCTGCACACAAAATGTGG - Exonic
963736743 3:149025916-149025938 TCCTCTCTGTTCACAATATGGGG - Intronic
967780460 3:193433699-193433721 TCCTCTCTGTGTATATATTTGGG + Intronic
967909991 3:194534664-194534686 TAATCGCTGTGTACAACATGTGG + Intergenic
967958848 3:194902085-194902107 TCCTCTAAGAGCACAAAATGGGG - Intergenic
970746824 4:19308271-19308293 TCCTCACTGAGAAAAAAATGAGG - Intergenic
970916024 4:21336313-21336335 TCTTCTCTGTGTACTTACTGAGG + Intronic
971441486 4:26692380-26692402 TCCCCTCTATAAACAAAATGAGG - Intronic
972726464 4:41750042-41750064 TCCTCTCGGTGGACAAGAGGGGG + Intergenic
972815594 4:42641571-42641593 TCTTTTCCATGTACAAAATGCGG - Intronic
975442478 4:74427553-74427575 TCATCCCTGTGTAACAAATGAGG - Intergenic
977954790 4:103014465-103014487 TCTCCTCTGTATACAGAATGTGG + Intronic
980192890 4:129547709-129547731 TCCTCCATGTGTAAAAAATAAGG - Intergenic
981088697 4:140710302-140710324 TCCCCTCTTTGTAAGAAATGAGG - Intronic
983875180 4:172866947-172866969 TCCTCTCTGAGGACAAGATCTGG - Intronic
984610526 4:181832153-181832175 TCCACTCTGAGTTCATAATGTGG - Intergenic
986249118 5:6040118-6040140 TCATCTCTGTCTAGAAAATAAGG + Intergenic
987203728 5:15603553-15603575 TCCACTCTGTGTAGGCAATGAGG + Intronic
990629678 5:57654270-57654292 TTCTCCCTGTGTAAAAAATGAGG - Intergenic
991602748 5:68370013-68370035 TCTTCTGGGTGTATAAAATGTGG + Intergenic
991674347 5:69076321-69076343 TCCTTCCTGTGTGGAAAATGTGG + Intergenic
993275544 5:85851726-85851748 TGCTCCCTGTGTACTAAATTGGG + Intergenic
993441600 5:87963210-87963232 TCCTCTCTGTTCACACTATGAGG + Intergenic
995581376 5:113606496-113606518 TCCTCTCTCTGTATGCAATGTGG + Intergenic
995687136 5:114783262-114783284 TCATCTCTGTTGACAACATGAGG + Intergenic
999424034 5:151470864-151470886 TCCTCTCTGTCTTCAGCATGTGG + Intronic
1000508396 5:162150372-162150394 TCCTCCCTGTTTTCAAATTGTGG - Intronic
1002785622 6:397523-397545 TCCTCTCTATATAAAAAGTGGGG - Intronic
1003800108 6:9654566-9654588 TCCTATGTATGTACAAAATGTGG - Intronic
1004277135 6:14247124-14247146 TCCTATCTGTGTTTAAACTGAGG - Intergenic
1006783167 6:36646241-36646263 TATTCTTTGTGTAAAAAATGGGG + Intergenic
1009932840 6:70196390-70196412 TGCTCTCTGTTTCCATAATGGGG + Intronic
1010616104 6:78014320-78014342 TACTCTCTGTGTGAAAAATATGG - Intergenic
1010684919 6:78842675-78842697 ACTTCTATGTGTACAAAATCAGG - Intergenic
1012259980 6:97077021-97077043 TCCTCTCTGTCTTCAGAAAGTGG - Intronic
1012395593 6:98793108-98793130 TCTTCTCTGTGAACTGAATGAGG - Intergenic
1014474596 6:121857032-121857054 TCCTAGCTGTGAACAAAAGGTGG - Intergenic
1015117376 6:129664453-129664475 TCCTCTATTTGTACACAATTTGG - Intronic
1023280072 7:38560252-38560274 TCCTCTCTGTGGACAAACCCAGG + Intronic
1027780773 7:82517304-82517326 TCCTCTCTTTGTCCATAATCTGG - Intergenic
1028450806 7:90980966-90980988 GCCTAGCTGTGTACATAATGGGG + Intronic
1030335629 7:108322944-108322966 TCCTCTCTGTGTACAAAATGGGG + Intronic
1031334978 7:120517571-120517593 ACCTCTCAGTGTACAAAGTAAGG + Intronic
1038079896 8:24122293-24122315 TCTCCTCTGTGTACAAAAACCGG - Intergenic
1038451839 8:27644477-27644499 TCCTCTCTGGGAACAAACTTGGG - Intronic
1039259989 8:35761068-35761090 TTCTCTCTATGGAAAAAATGTGG - Intronic
1041750799 8:61259116-61259138 TCATCTCTGTTTAGAAACTGAGG + Intronic
1045327480 8:101127498-101127520 AGCTCTTTGTGTATAAAATGGGG + Intergenic
1045860477 8:106810877-106810899 TCCTCCCAGGGTACATAATGTGG - Intergenic
1046794452 8:118355664-118355686 TTCTTTCTGTGTACATAAAGAGG - Intronic
1048052127 8:130828202-130828224 TCCTCTCTGTGTATGCAATGTGG + Intronic
1049795675 8:144496311-144496333 TGCTCTCTGTGGACAAAGGGTGG + Intronic
1050600118 9:7242009-7242031 TACTCACTGTGAAGAAAATGAGG + Intergenic
1053290238 9:36874974-36874996 TCCTCCTCGTGTATAAAATGGGG - Intronic
1055289190 9:74764933-74764955 TCATCTCTGATTACATAATGAGG - Intronic
1056850075 9:90075991-90076013 TCCTCTCTCTGGAGAAAATCTGG + Intergenic
1058062104 9:100509022-100509044 TCCTGTCTGTGGATCAAATGGGG + Exonic
1058814594 9:108671578-108671600 TCCTCTCTGTTTAAAATATGTGG + Intergenic
1059578642 9:115519686-115519708 TCCTCTCTGTAGATATAATGGGG - Intergenic
1059936967 9:119321237-119321259 TCCTCACCATGTATAAAATGGGG - Intronic
1186161466 X:6781453-6781475 TCATCTCTGGGTCCAAAATTGGG - Intergenic
1187830663 X:23378129-23378151 TGCTTTCTCTGTATAAAATGTGG - Intronic
1189699964 X:43708396-43708418 CCCTCTCAGTCTCCAAAATGTGG - Intronic
1190023141 X:46897455-46897477 TCCTCTCTGTATGCAATGTGTGG + Intronic
1190092174 X:47448772-47448794 CCCTATCTGTGTACTCAATGTGG - Exonic
1191594775 X:62930925-62930947 TACTCTCTGTGAACAAAATTTGG - Intergenic
1192424620 X:71064619-71064641 TCTTCTCAGTGTTTAAAATGTGG - Intronic
1193102321 X:77628276-77628298 TCCTCTCAAGCTACAAAATGTGG + Intronic
1194570919 X:95553703-95553725 TCATCTCTGAGCAGAAAATGAGG - Intergenic
1195431645 X:104796158-104796180 TTTTCTCTGTCTATAAAATGAGG + Intronic
1195521419 X:105834234-105834256 TTCACACTGTGTATAAAATGTGG + Intronic
1196051623 X:111311972-111311994 AAATCTCTGTGTAGAAAATGTGG - Intronic
1197332652 X:125173147-125173169 TCATGTCTGTTTATAAAATGTGG - Intergenic
1198147795 X:133875227-133875249 TCGTCTCTGTGTATATCATGTGG - Intronic
1198165824 X:134055911-134055933 TCCTCTCTGTGTTTGATATGGGG - Intergenic