ID: 1030339930

View in Genome Browser
Species Human (GRCh38)
Location 7:108366014-108366036
Sequence AGACTGGGGCCCTCATAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030339921_1030339930 21 Left 1030339921 7:108365970-108365992 CCTTTAAGAGTAATTTAATCATC 0: 1
1: 0
2: 1
3: 13
4: 267
Right 1030339930 7:108366014-108366036 AGACTGGGGCCCTCATAGAAGGG 0: 1
1: 0
2: 0
3: 16
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030339930 Original CRISPR AGACTGGGGCCCTCATAGAA GGG Intronic
900434248 1:2620639-2620661 AGTCTGGTGCCCTCATAAGAGGG + Intronic
904208605 1:28871304-28871326 AGACTGGGGGCCCCTTACAAGGG - Intergenic
904830734 1:33305045-33305067 AAACTGGGGCCCTGAGAGACTGG - Intergenic
910159183 1:84255288-84255310 AGAGTGGAGCCCTCATAAATGGG + Intergenic
914959571 1:152194557-152194579 TGACTGGGGCCCTAATATATTGG - Intergenic
916628067 1:166581129-166581151 AGAATGTGGCCCTCATGGAAAGG - Intergenic
924178026 1:241412529-241412551 AGCCTGGAGCCTTCATAGATTGG - Intergenic
1063750049 10:8933920-8933942 TGACTGGCGCCCTCATTAAAAGG - Intergenic
1066586877 10:36945378-36945400 AGAGTGGAGCCCTCATAAATGGG - Intergenic
1068084191 10:52354291-52354313 TGACTGCAGGCCTCATAGAAAGG - Intergenic
1071374346 10:84987274-84987296 TGACTGGTGTCCTCATAAAAAGG + Intergenic
1071562083 10:86652531-86652553 AGAGTGGGGTCCACATTGAATGG + Intergenic
1072108095 10:92292210-92292232 CGACTGGGGCCCCCCAAGAATGG - Intronic
1073319224 10:102604178-102604200 TGGCTGGGGCCCTAAGAGAAGGG - Intronic
1076813952 10:132905292-132905314 AGACAGAGTCCCTCATAGGACGG - Intronic
1078056584 11:8014234-8014256 AGACTTGAGGACTCATAGAAGGG + Intergenic
1078387919 11:10909269-10909291 AGACTGGGGTCCTTATAAGAGGG - Intergenic
1078587023 11:12600718-12600740 AGAGTGGAGCCCTCATGGATGGG + Intergenic
1079325694 11:19489520-19489542 AGACTGTGACCCTCATTTAATGG - Intronic
1081614071 11:44580019-44580041 AGATAGGGACCCTCACAGAAGGG + Intronic
1081667901 11:44927203-44927225 ACTCTGGGGCCCTCAGATAAAGG - Intronic
1081911542 11:46703108-46703130 AGACTTGGGCCCTCAGAGGAAGG - Exonic
1083420220 11:62548046-62548068 AGACATGGGCACTCATATAATGG + Intronic
1084409268 11:68997041-68997063 AGGCTGGGGCCTTCAAGGAAAGG + Intergenic
1084510050 11:69597645-69597667 TGACTGTGGCCCTCATGAAAAGG - Intergenic
1084538083 11:69769582-69769604 TGACTGGTGCCCTCCTACAAAGG - Intergenic
1085284461 11:75350903-75350925 AGACTGATGCCCTCAAAGACTGG - Intronic
1085395286 11:76203972-76203994 AGACTGGGGCACACAGAGATGGG - Intronic
1085901386 11:80703733-80703755 AGAGTGGAGCCCTCATAAATGGG + Intergenic
1086742121 11:90380604-90380626 AGTCTGTGGCACTCACAGAAAGG - Intergenic
1087558794 11:99757421-99757443 AGAGTGGGGCACTTATAGTATGG - Intronic
1089194980 11:116689052-116689074 TGACTGGCGTCCTTATAGAAAGG + Intergenic
1095906422 12:47382807-47382829 TGACTGGTGTCCTCATAAAAAGG - Intergenic
1097630427 12:62055069-62055091 AGAGTGGAGTCCTCATAGATGGG + Intronic
1099056223 12:77844331-77844353 AGGATGGAGCCCTCATAGATGGG - Intronic
1103963191 12:124622161-124622183 ATCCTGGGGCCCCCAGAGAATGG + Intergenic
1105477338 13:20739959-20739981 CGACTGGGCCCCGCAGAGAAGGG + Intronic
1105968088 13:25403011-25403033 GGACTGGTGCCCTTATAAAAGGG - Intronic
1106139588 13:27001092-27001114 AGACTGGTGTCCTTATAAAAGGG + Intergenic
1106362485 13:29045392-29045414 AGAGTGGGGCCCTCATGAATGGG - Intronic
1106392678 13:29350864-29350886 AGAGTGGGGCCCTCATGAATGGG - Intronic
1106588043 13:31073962-31073984 AAACTGGGGCCCTGGTGGAAGGG - Intergenic
1107844450 13:44496939-44496961 AAACTGGATCCCTCATACAATGG + Intronic
1110950646 13:81485782-81485804 GGACTGGTGCCCTCATAAAAGGG + Intergenic
1112129323 13:96504022-96504044 AGGGTGGAGCCCTCATAGATGGG - Intronic
1113770302 13:112904068-112904090 AGACTTGGGCGCTCAGGGAAAGG - Intronic
1118007496 14:61576780-61576802 GGACTGGAACCCTCATAGCATGG + Intronic
1118338038 14:64871375-64871397 AGACTGGTGCCAGAATAGAATGG + Intronic
1118648747 14:67867678-67867700 AAACTGGGGCTCTCATAGCGAGG + Intronic
1120400360 14:84023124-84023146 AGACTGTGGGCTACATAGAAGGG - Intergenic
1121494938 14:94385699-94385721 AGACAGGTGCCCTCCTAGACAGG + Intronic
1121986182 14:98508333-98508355 AGACTGAGGCACTGATATAATGG + Intergenic
1202841691 14_GL000009v2_random:126750-126772 AGACTGGGGCCCACAAAGAGAGG - Intergenic
1202911079 14_GL000194v1_random:116982-117004 AGACTGGGGCCCACAAAGAGAGG - Intergenic
1202881539 14_KI270722v1_random:65680-65702 AGACTGCGGCCCACAAAGAGAGG + Intergenic
1126695463 15:51321856-51321878 AGGCCTGGGCCCTCATCGAAAGG + Intronic
1127123588 15:55791582-55791604 AGATTAGGGCCCTTATAAAAGGG - Intergenic
1127361039 15:58245445-58245467 AGACTGTGAACTTCATAGAAAGG - Intronic
1127492097 15:59474499-59474521 GGACTGGGGCCCTTATAAAAAGG - Intronic
1129326239 15:74801643-74801665 AGACTGGGGCTCCCATAGCAGGG - Intronic
1132286973 15:100670489-100670511 AGACTGGTGTCCTTATAAAAAGG - Intergenic
1132550175 16:550944-550966 CGACCGGGGCCCTCACAGACAGG - Intronic
1132669504 16:1096827-1096849 GGCCTGGGGCCCACAGAGAATGG - Intergenic
1133907669 16:10036825-10036847 AGACTGGTGTCCTTATAAAAAGG - Intronic
1134350115 16:13429522-13429544 TGACTGGTGTCCTTATAGAAAGG - Intergenic
1134855130 16:17512172-17512194 AGACTGGTGTCCTTATAAAAAGG - Intergenic
1136574096 16:31113044-31113066 AAGGTGGGGCCCTGATAGAAAGG + Intergenic
1140928911 16:79609214-79609236 AGACTGGGATCCTCAGAGATTGG + Intergenic
1141192244 16:81833240-81833262 AGGCTGTGGCCCCCACAGAAAGG - Intronic
1141222848 16:82087871-82087893 AGAGTGGGGTCGTCATAAAAAGG - Intronic
1148891177 17:50808533-50808555 ATACTGGGACCCTCAGAAAAGGG + Intergenic
1150650830 17:67008993-67009015 TGACTGGGGCCCTTATGAAAAGG + Intronic
1150841442 17:68610745-68610767 AGGATGGGGCCCTCATAAATGGG - Intergenic
1150861506 17:68805648-68805670 TGACTGGGGTCCTTATAAAAAGG + Intergenic
1151522373 17:74639590-74639612 AAACTGGAGCCCTCATAAATGGG - Intergenic
1152419843 17:80186511-80186533 GAAGTGGGGCCCTCAGAGAATGG - Intronic
1203186700 17_KI270729v1_random:129592-129614 AGAATGGAGTCCTCATCGAATGG - Intergenic
1153431535 18:5022838-5022860 AGACTAGGGAACTCACAGAAGGG + Intergenic
1156162549 18:34376938-34376960 AGAGTGGAGCCCTCATGGATGGG - Intergenic
1158212783 18:55069265-55069287 AGACTGGTGTCCTTATAAAAAGG - Intergenic
1164017042 19:21262459-21262481 ACCCTGGGGCCCTTATAGGATGG + Intronic
1164511344 19:28899681-28899703 AGAGTGGAGCCCTCATGGATGGG + Intergenic
1202657151 1_KI270708v1_random:34777-34799 AGACTGCGGCCCACAAAGAGAGG + Intergenic
925534500 2:4901698-4901720 AGACAGGGTCCCTTAGAGAAAGG - Intergenic
926687005 2:15705718-15705740 TGACTGGTGTCCTCATACAAAGG - Intronic
927451193 2:23210876-23210898 TGACTGGTGCCCTCATAAAAAGG + Intergenic
927663040 2:25008973-25008995 AGACTGGAGCCCTCATAAATGGG - Intergenic
929944726 2:46361838-46361860 AGACTGGGGTTGTCATAGGAGGG + Intronic
930255126 2:49081934-49081956 ACACTTGGGCCATCATAAAAAGG - Intronic
930613985 2:53574347-53574369 AGGCTGGGGCCCTTATAAATGGG + Intronic
931912353 2:66914499-66914521 TGACTGGTGTCCTCATAAAAGGG - Intergenic
935285507 2:101560695-101560717 TGACTGAAGCCCTCATAGGAAGG + Intergenic
936602793 2:113915385-113915407 TGACTAGTGTCCTCATAGAAAGG - Intronic
940013573 2:149080287-149080309 CGACTGGTGGCCTCACAGAAGGG - Intronic
940260610 2:151776027-151776049 GGATTAGGGCCCTCATAAAAGGG + Intergenic
940746577 2:157574350-157574372 AGACTAGTGCCCTCATAAAATGG - Intronic
942076315 2:172359803-172359825 TGACTGGTGCCCTTATAAAAAGG - Intergenic
943650660 2:190454445-190454467 AGAGTGGGGCCCTCATAATGGGG + Intronic
944450116 2:199834132-199834154 TGACTGGGGTCCTCATAAAAAGG + Intronic
948185537 2:236018770-236018792 AGAAACGGGCCCTCATAGACGGG - Intronic
948590142 2:239044131-239044153 AGAGTGTGGACCTCATAGGAAGG + Intergenic
1170147978 20:13198404-13198426 AGATTAGTGCCCTCATAAAAGGG - Intergenic
1170368289 20:15620316-15620338 GGTCTGGGGCCATCAAAGAAGGG + Intronic
1170743564 20:19078834-19078856 AGAATGGGGCCCTCATGAATGGG + Intergenic
1174631466 20:51962070-51962092 AGATTGGGGCCATCCTAAAATGG + Intergenic
1175176516 20:57115607-57115629 AGGGTGGGGCTCTCATAGATGGG - Intergenic
1175507646 20:59497192-59497214 TGACTGGGGTCCTTATAAAAGGG - Intergenic
1176630434 21:9131679-9131701 AGACTGGGGCCCACAAAGAGAGG - Intergenic
1179992289 21:44954355-44954377 AGACGGGGCCCCTGAGAGAAGGG - Intronic
1182029216 22:27144365-27144387 TGACTGGGGTCCTTTTAGAAAGG + Intergenic
1182756503 22:32683928-32683950 CTACTGGGGCCCTCACTGAATGG + Intronic
1184041937 22:41949549-41949571 AGACTGAGGCCCTTAGAGAGTGG + Intergenic
949896475 3:8770571-8770593 AGACTGAGGCCCAAAGAGAAGGG - Intronic
950144818 3:10641427-10641449 GGACTTGGGCCCTCATATACGGG - Intronic
950523265 3:13508783-13508805 AGGCTGGGGCCCGCAGAGACGGG + Intergenic
953825363 3:46247340-46247362 AGACTGGGGGCCTAATGAAAAGG + Intronic
954925816 3:54233349-54233371 AGACTGTGGGCTGCATAGAAAGG + Intronic
955957952 3:64309862-64309884 AGACAGTGGCCCTCAAAGTATGG + Intronic
956143870 3:66172850-66172872 TGACTGGTGTCCTCATAAAAAGG - Intronic
956849310 3:73213763-73213785 ATACTGGTGCCCTTATAAAAAGG + Intergenic
957178747 3:76848745-76848767 AGAGTGGAGCCCTCATAAATGGG - Intronic
959633481 3:108535445-108535467 AGAGTGGAGCCCTCATAAATGGG - Intergenic
961948485 3:130719929-130719951 ATTCTGGGGCCCTCATTGTAGGG - Intronic
962234772 3:133698634-133698656 AGACTGGTGTCCTCATGAAAAGG - Intergenic
962267818 3:133955914-133955936 TGTCTGGGACCCTCACAGAAGGG - Intronic
963765285 3:149328324-149328346 AGAGTGGTGCCCTTATAAAAGGG - Intronic
969058860 4:4419368-4419390 AGACTGGGGCCCTCAGTGAGGGG - Exonic
969391787 4:6896211-6896233 AGGGTGGAGCCCTCATAGACGGG + Intergenic
969695002 4:8729392-8729414 AGAAGGGGGCCCTCATGGGAGGG + Intergenic
969965147 4:10986409-10986431 AGAATGGAGCCCTCATACATAGG + Intergenic
970874193 4:20850439-20850461 ATGATGGGGCTCTCATAGAATGG + Intronic
971267160 4:25105860-25105882 AGACTGGCGTCCTTACAGAAAGG + Intergenic
974269777 4:59634868-59634890 AGACTGGTGCATTCATAAAAGGG + Intergenic
976505027 4:85836541-85836563 TGACTGGTGTCCTCATAAAAAGG - Intronic
980446071 4:132909398-132909420 AGACAGGGGCAGTCATAGCAAGG + Intergenic
982831272 4:160063699-160063721 ACACTGGAGACCTCAAAGAAGGG - Intergenic
983433565 4:167682591-167682613 AGACTGGTGCCTTTATAAAAAGG + Intergenic
984164032 4:176286557-176286579 AGACTGCTGCCATCAGAGAATGG - Intergenic
985764546 5:1769843-1769865 ATAATGGGGCCTCCATAGAAGGG + Intergenic
986051519 5:4094605-4094627 AGACTGGGGCCCGGAGAGAGAGG + Intergenic
986101087 5:4612515-4612537 AGCCTGGGGCCCCCAGAGACTGG + Intergenic
986606091 5:9524365-9524387 TGACTGGGGTCTTCATAAAACGG + Intronic
986670657 5:10140120-10140142 AGATTAGTGCCCTTATAGAAGGG + Intergenic
990237959 5:53788159-53788181 AGGCTGGGGGGCTCAGAGAAGGG + Intergenic
990241459 5:53820231-53820253 AGACTGGTGCCCACAGAGCAGGG + Intergenic
993089194 5:83402921-83402943 AGACTGTGGTCCCCAAAGAAAGG + Intergenic
993882636 5:93380975-93380997 AGAGTGGGGCCCTCATGCATGGG + Intergenic
995330543 5:110940764-110940786 AGTCTGAGGCACTCATAGAGAGG - Intergenic
995773509 5:115699270-115699292 AGGGTGGAGCCCTCATAAAAGGG + Intergenic
998927736 5:147145193-147145215 AGACTGGTGTCTTCATAGCAAGG - Intergenic
1000748503 5:165065832-165065854 TGACTGGGGTCCTTATAAAAAGG - Intergenic
1001095660 5:168773632-168773654 AGACTGGAGCCATCAAAAAATGG + Intronic
1001692610 5:173644159-173644181 AGACTGGAGCCAACAGAGAAGGG + Intergenic
1002212835 5:177608773-177608795 AGACTGGGGCCCACAGGGCAAGG - Intronic
1005856501 6:29866883-29866905 AGCCTGGGGCCCACAGGGAATGG - Intergenic
1006124249 6:31827501-31827523 GGACAGGGGCCCTGAGAGAAAGG - Intergenic
1007276918 6:40680702-40680724 AGACTGGGGCCCCCTGAGGATGG - Intergenic
1007363085 6:41372536-41372558 AGCGTGGGGCCCACAGAGAAGGG - Intergenic
1007707124 6:43797916-43797938 AGACTGGGGCTCCCGTAGGACGG - Intergenic
1007707146 6:43797993-43798015 AGACTGGGGCTCCCGTAGGACGG - Intergenic
1009059947 6:58386998-58387020 AGACTGTGGCTCTCACAGAGAGG + Intergenic
1013196057 6:107846348-107846370 TGACTGGTGTCCTCATAAAAAGG + Intergenic
1013765049 6:113564766-113564788 GGACTGGGGCCCACAGAGCATGG + Intergenic
1014577737 6:123094104-123094126 AGAGTGGGGCCAGCATATAATGG + Intergenic
1015065615 6:129022945-129022967 GGAGTGGGGCCCTGATATAACGG - Intronic
1015798468 6:137036463-137036485 TGACTGGTGTCCTCATAAAAAGG + Intronic
1018474044 6:164122696-164122718 GGACTGGGGTTCTCTTAGAAAGG + Intergenic
1019435732 7:1021203-1021225 AGACTGGGGACCTCCCAGCACGG + Intronic
1019923335 7:4176703-4176725 ACTCTGGGGACCTCATAGAAGGG + Intronic
1020403633 7:7805491-7805513 AGAATGGGGCCCTAGTAAAAGGG - Intronic
1021582678 7:22173770-22173792 AGGCTGCGGCACTCAGAGAAAGG + Intronic
1022492486 7:30831583-30831605 AGCCTGGGGCTCTGGTAGAAGGG + Intronic
1025558150 7:62335637-62335659 AGAATGGAGTCCTCATCGAATGG + Intergenic
1025559800 7:62357393-62357415 CGAATGGAGCCCTCATCGAATGG + Intergenic
1028416783 7:90589155-90589177 AGAGTGGGGCCCTCATGAATGGG + Intronic
1030339930 7:108366014-108366036 AGACTGGGGCCCTCATAGAAGGG + Intronic
1031640726 7:124161156-124161178 GAACTTGGGCCCTCATGGAAAGG + Intergenic
1032581809 7:133110390-133110412 AGATTGGAGCCCTCATACATTGG + Intergenic
1032653661 7:133905268-133905290 AGAGTGAGGTACTCATAGAAAGG - Intronic
1032829065 7:135604022-135604044 TGACTGGTGTCCTCATAAAAAGG - Intronic
1034151527 7:148920333-148920355 AGACTGCTGCACTCATAGTAAGG - Intergenic
1034496149 7:151423839-151423861 TGACTGGTGTCCTCATAAAAAGG - Intergenic
1035116833 7:156531958-156531980 AGACTGGGGCCTACTTAGATAGG + Intergenic
1036903768 8:12690869-12690891 AGACTGGGGCCCTGCCAGTAAGG - Intergenic
1037025577 8:14032190-14032212 TGACTGGTGTCCTTATAGAAAGG - Intergenic
1038078196 8:24101871-24101893 CAACAGAGGCCCTCATAGAATGG - Intergenic
1039393975 8:37207019-37207041 ACCCTGAGGCCCTCATAGCAGGG + Intergenic
1041459990 8:58100674-58100696 AGACTGGTGTCCTTATAAAAAGG - Intronic
1043347747 8:79319636-79319658 TGACTGGTGTCCTCATAAAAGGG - Intergenic
1043725943 8:83611191-83611213 AGACTGGGCACCTCAGAGCAGGG + Intergenic
1045470337 8:102506775-102506797 GGACTTGGGCCCTTGTAGAAGGG - Intergenic
1046926279 8:119792718-119792740 GGATTAGCGCCCTCATAGAAAGG + Intronic
1047172760 8:122510000-122510022 TGACTGGTGTCCTTATAGAAAGG + Intergenic
1048892018 8:138956604-138956626 AGACTGGTGTCCTTATGGAAAGG + Intergenic
1049045955 8:140151561-140151583 TGCCTGGTGTCCTCATAGAAAGG - Intronic
1049365494 8:142234926-142234948 AGACTGGGGCACTCACACACTGG - Intronic
1050611747 9:7360792-7360814 ACACTGTGTCCCCCATAGAAAGG + Intergenic
1050839405 9:10128337-10128359 TGACTGGTGCCCTTATAAAAAGG + Intronic
1051088637 9:13380796-13380818 TGACTGGAGTCCTTATAGAAAGG + Intergenic
1052444411 9:28541967-28541989 AGACTGAAGCCATTATAGAATGG + Intronic
1057262336 9:93592089-93592111 GGACTGGGGACCTCCAAGAATGG - Intronic
1058779710 9:108320545-108320567 AGCTTGTGGCCCTCAAAGAAGGG - Intergenic
1060530768 9:124346055-124346077 AGCTTGGGCCCCTCAGAGAAGGG - Intronic
1060745851 9:126130390-126130412 AGACCCAGGCCCCCATAGAATGG - Intergenic
1061430166 9:130525993-130526015 AGACTGAGGCCCATAGAGAAGGG + Intergenic
1203753263 Un_GL000218v1:99364-99386 AGACTGGGGCCCACAAAGAGAGG - Intergenic
1185764678 X:2715850-2715872 TGACTGGTGCCCTTATAGGAAGG - Intronic
1186659336 X:11652799-11652821 AGACTGGGGGTGTCATAGATGGG + Intronic
1187679893 X:21757341-21757363 AACCTGGTGCCCACATAGAAAGG + Intronic
1189256851 X:39646577-39646599 AGAGTGGAGCCCTCATAAATGGG + Intergenic
1190127401 X:47719016-47719038 GGACTGGAGCCCTTTTAGAATGG + Intergenic
1190371787 X:49749567-49749589 AGAATGGTGCCCTCATGGATGGG - Intergenic
1192299212 X:69882523-69882545 CTACTGGGGACCTCATAAAATGG - Intronic
1196867437 X:120083024-120083046 ACCCTGGGGCCCTTATAGGATGG - Intergenic
1196875662 X:120153258-120153280 ACCCTGGGGCCCTTATAGGATGG + Intergenic
1199226218 X:145377878-145377900 AGACTGGGGCCCTTATGAATAGG + Intergenic
1199286358 X:146058957-146058979 AGAGCGGGGCTCTCAGAGAAAGG + Intergenic
1199355051 X:146852816-146852838 AGTCTGGGGCTATCATAGACAGG + Intergenic
1199694247 X:150332236-150332258 TGACTGGTGTCCTCATATAAAGG + Intergenic
1200116305 X:153771176-153771198 AGACTGGGGCCCACAGACAGAGG - Intronic
1200804011 Y:7413545-7413567 AGACTAGTGCCCTTATAAAAGGG - Intergenic
1201166909 Y:11216933-11216955 AGACTGGGGCCCACAAAGAGAGG - Intergenic