ID: 1030344340

View in Genome Browser
Species Human (GRCh38)
Location 7:108415583-108415605
Sequence CATAAAAAGGAGAAGAAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030344334_1030344340 -3 Left 1030344334 7:108415563-108415585 CCTACATCCTAATTTCTACCCAT 0: 1
1: 0
2: 0
3: 23
4: 245
Right 1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG No data
1030344335_1030344340 -10 Left 1030344335 7:108415570-108415592 CCTAATTTCTACCCATAAAAAGG 0: 1
1: 0
2: 2
3: 22
4: 280
Right 1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030344340 Original CRISPR CATAAAAAGGAGAAGAAGGC CGG Intronic
No off target data available for this crispr