ID: 1030345754

View in Genome Browser
Species Human (GRCh38)
Location 7:108431279-108431301
Sequence CTGTGGCAGTGGAAGTGGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 693
Summary {0: 1, 1: 1, 2: 8, 3: 127, 4: 556}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030345754 Original CRISPR CTGTGGCAGTGGAAGTGGCA CGG (reversed) Intronic
900013341 1:133814-133836 CTGGGGCAGAGGCAGTGGCAGGG - Intergenic
900043405 1:489801-489823 CTGGGGCAGAGGCAGTGGCAGGG - Intergenic
900064843 1:724798-724820 CTGGGGCAGAGGCAGTGGCAGGG - Intergenic
900860156 1:5223186-5223208 CTGTGGCAGAGGAAGGGTCCAGG + Intergenic
901051416 1:6427570-6427592 CTGTGGAGGTGGAAGTTGCTGGG - Intronic
902300982 1:15502581-15502603 CTGGGGAAGGTGAAGTGGCAGGG + Intronic
902872810 1:19324610-19324632 CTGTGGAAGAGGAAGAGGAAGGG - Intronic
903419111 1:23205914-23205936 CAGTGGCAGTGGGAGTGGAGGGG - Intergenic
904001833 1:27343132-27343154 CCGTGGCAATGGAAGGGGCGGGG + Intronic
904572453 1:31477187-31477209 CTGCTCCAGTGGAGGTGGCAGGG + Intergenic
904783964 1:32971763-32971785 CTGTGGTATTGGAGGTGCCAAGG - Intergenic
905405937 1:37732423-37732445 CTGGGGCTGTGGATATGGCAGGG - Intronic
905547098 1:38808508-38808530 CTGAGGCAGAGGAAGTGGAAGGG + Intergenic
905860874 1:41350201-41350223 CTGGGGCGGTGGAAGTCACAAGG + Intergenic
905893943 1:41533359-41533381 CTGTGGTGGTGGAAGGGGCTAGG - Intronic
906053916 1:42899664-42899686 CTGTTCCAGTGGAGGTGGCAGGG + Intergenic
906166425 1:43689777-43689799 CTGTGGTGGTTAAAGTGGCATGG + Intronic
906578825 1:46917544-46917566 CTGCTCCAGTGGAGGTGGCAGGG + Intergenic
907761210 1:57362625-57362647 CTTCTGCAGTGGAAGGGGCAAGG - Intronic
907855086 1:58295400-58295422 CCATGGGAGTGGAGGTGGCAGGG + Intronic
907909005 1:58810829-58810851 CTGGGGCAGGGGAAGAGGAAGGG - Intergenic
908206137 1:61851785-61851807 CTGTGGCAGTGGAAATGGAAAGG + Intronic
908514947 1:64883129-64883151 AAGTGGCAGTGGCAGAGGCAGGG + Intronic
908691636 1:66786513-66786535 CAGTGGCATTGGAAATGGAAAGG + Intergenic
909673635 1:78214814-78214836 CTGTTCCAGTGAAGGTGGCAGGG - Intergenic
912239859 1:107894985-107895007 CTTTGGCAGTGGAGGTGAGAGGG - Intronic
912326591 1:108769297-108769319 CAGAGGCAGAGGAGGTGGCAGGG + Intronic
912638361 1:111320116-111320138 CTGTGGGAGTGGAAGTGTGGAGG - Intronic
913099721 1:115551923-115551945 TAGTGGCAGTGGATGTGGGAGGG - Intergenic
913143180 1:115962169-115962191 CTGTTCCAGTGGAGGTGGCAGGG - Intergenic
913339683 1:117746734-117746756 CTGCTCCAGTGGAAGTGGCAGGG + Intergenic
914666909 1:149840165-149840187 CTGTGCTAGTGGAGGTGGCGCGG + Exonic
914668858 1:149853625-149853647 CTGTGCTAGTGGAGGTGGCGCGG - Exonic
914707072 1:150179156-150179178 CTGGGGCAGAGGCAGTGGGAAGG - Intergenic
914993284 1:152516750-152516772 CTGTGGCAGTGGCAATGGATGGG + Intronic
915184076 1:154089436-154089458 CTGTGGCAGAGGACATGGCTGGG + Exonic
916064623 1:161126125-161126147 CCATGGCAGTGGAGGTGGAAAGG - Intronic
916473840 1:165149435-165149457 CTTACGCAGTGGAAGGGGCAAGG + Intergenic
916682569 1:167117680-167117702 CTGGGGCAGGGTAAGTGGCTAGG - Intronic
916757342 1:167785387-167785409 CAGTGAGAGTGGAAGTGGCAAGG + Intronic
917178071 1:172261628-172261650 CCTGGGCAGTGGATGTGGCATGG + Intronic
917520046 1:175740774-175740796 CTGTGGCTCTGAATGTGGCAAGG - Intronic
917596428 1:176533586-176533608 CCATGGCTGTAGAAGTGGCAGGG - Intronic
918158410 1:181873019-181873041 CTGTTCCAGTGGAGGTGGCAGGG - Intergenic
918230333 1:182524389-182524411 CAGTGCAAGTGGAAGTGGAAGGG + Intronic
918750714 1:188266145-188266167 CTGTTCCAGTGGAGGTGTCAGGG + Intergenic
919397566 1:197069729-197069751 CTGTTCCAGTAGAGGTGGCAGGG - Intergenic
919576495 1:199316684-199316706 CTCTGTCAATGCAAGTGGCAGGG + Intergenic
919786004 1:201259197-201259219 GGGGGGCAGTGGAGGTGGCATGG + Intergenic
919880507 1:201897814-201897836 ATGTGGCAGGGGCAGTGGCCTGG - Exonic
920123583 1:203676349-203676371 CTGAGGGATTGGAAGTGGCCAGG + Intronic
920219687 1:204387746-204387768 AGGGGGCAGTGGAAGTGGAAAGG - Intergenic
920227191 1:204447342-204447364 CTTTGGGAGTGGAGGTGGGAAGG - Intronic
921509781 1:216014120-216014142 ATGTGGCAGAGAAAGTTGCACGG + Intronic
922261782 1:223950309-223950331 CTGGGGCAGAGGCAGTGGCAGGG - Intergenic
922395958 1:225201751-225201773 CTGCTTCAGTGGAAGTGGCAAGG + Intronic
922735296 1:227975433-227975455 CTGGGGCAGAGGCAGTGGCAGGG + Intergenic
923174101 1:231446448-231446470 CTGCTCCAGTGGAGGTGGCAGGG - Intergenic
923496640 1:234531384-234531406 CTGTAGCAGTGGAGGTGGCCGGG + Intergenic
923563226 1:235057499-235057521 TGGTGGCAGTGGAAGTGAGAAGG + Intergenic
924050027 1:240071178-240071200 CTATGGCTGTGACAGTGGCAAGG + Intronic
924120259 1:240790154-240790176 CTGGGGAGGTGGAAGTTGCAGGG + Intronic
924321363 1:242854538-242854560 CTGTTTCAGTGGAGGTGGCAGGG + Intergenic
924342948 1:243052484-243052506 CTGGGGCAGAGGCAGTGGCAGGG - Intergenic
924409229 1:243785721-243785743 CTCTGGCAGTGCAGCTGGCATGG - Intronic
1063153216 10:3355461-3355483 GTGTGGCATTGGGAGTGACAGGG + Intergenic
1063194656 10:3730129-3730151 GTGTGGCAGAGGAGGTGGCAGGG + Intergenic
1066647284 10:37622591-37622613 CTGTGGTGGTGGATGTGGCCAGG + Intergenic
1066733532 10:38453068-38453090 CTGGGGCAGAGGCAGTGGCAGGG + Intergenic
1067155975 10:43781736-43781758 TTGAGGCAGTGGGAGTGGGAAGG + Intergenic
1067717133 10:48698350-48698372 TTGTGGCTGTGGCAGTGACAAGG + Intronic
1067777506 10:49174244-49174266 CTGAGGCAGGGGCAGGGGCAGGG - Intronic
1070239594 10:74665399-74665421 CTGGGTCAGAGGCAGTGGCAGGG + Intronic
1070700320 10:78597294-78597316 ATGTGGCAGTGGATGGGGCTTGG - Intergenic
1070770956 10:79082107-79082129 CTGTGGCAGTGGCACTGGCCTGG + Intronic
1070784363 10:79154498-79154520 CCCTGGCATTGCAAGTGGCAAGG + Intronic
1071910690 10:90229605-90229627 CTGCTTCAGTGGAGGTGGCAGGG - Intergenic
1072928029 10:99633905-99633927 CTGTTCCAGTGCAGGTGGCAGGG - Intergenic
1073132115 10:101196313-101196335 CTGTGGCAGAGAAACTAGCAGGG - Intergenic
1073271128 10:102265029-102265051 CTGTGGCATGGGATGGGGCATGG + Intronic
1073322100 10:102621628-102621650 CGATGGCAGTGGAGGAGGCAGGG - Intronic
1073700913 10:105925683-105925705 CTGTGCTGGTGGAGGTGGCAGGG - Intergenic
1073727231 10:106247629-106247651 CTGTGGCAGTGGATGGGGGTTGG - Intergenic
1074825697 10:117214326-117214348 CTCTGGCAATGGAATTGACAAGG + Intergenic
1075252620 10:120894341-120894363 CTGTGGCAGATGAAGAGGAAAGG - Intronic
1075379990 10:122011234-122011256 GTGTGGCTGGGGAAGTGGGAAGG + Intronic
1075655304 10:124157095-124157117 CTGTTGCCGTGGCAGTGGCTGGG - Intergenic
1075724585 10:124604881-124604903 CAGGGGCAGGGGAAGGGGCAGGG - Intronic
1076093692 10:127712990-127713012 CTGTCGCAGTGGCAGGTGCATGG - Intergenic
1076192475 10:128492348-128492370 CTGAGGCTGTGCAAGTGCCAGGG + Intergenic
1076206922 10:128611098-128611120 CTTTGGCAATGCAAGAGGCAAGG - Intergenic
1076215957 10:128693584-128693606 CCGGGGCAGGGGAAGTGGCTGGG - Intergenic
1076375924 10:129984637-129984659 CTGCTCCAGTGGAGGTGGCAGGG - Intergenic
1076391791 10:130109045-130109067 CTGATGGAGTGGCAGTGGCAGGG - Intergenic
1076411552 10:130255092-130255114 CTGTGGCTGTTGAAGGGGCCTGG + Intergenic
1076566121 10:131400659-131400681 CTGTGGCAGTGCAAAGGGGAGGG + Intergenic
1076666253 10:132094633-132094655 CTGTTCCGGTGGAGGTGGCAGGG + Intergenic
1076783542 10:132737608-132737630 CTGTGGCTGAGGAGCTGGCAGGG - Intronic
1076969678 11:126018-126040 CTGGGGCAGAGGCAGTGGCAGGG - Intergenic
1077054005 11:581377-581399 CTGTGGCGGTGGATGTGACACGG + Intronic
1077319466 11:1934806-1934828 CTGGGGCAGAGGAAGTGGTGAGG - Intronic
1077874677 11:6294111-6294133 CAGGGGCAGGGGAAGGGGCAGGG + Intergenic
1078093589 11:8282979-8283001 CTGTGGCAGCGGAAGGAGAAAGG - Intergenic
1078463544 11:11533430-11533452 CTGTGGCATTGGAACAGGCTTGG - Intronic
1078605368 11:12770390-12770412 CTGTGGCAGTGGATGAGCCCTGG + Intronic
1079273662 11:19013275-19013297 CTGTTCCAGTGGAGGTGGCAGGG + Intergenic
1080203295 11:29699261-29699283 CTGCTCCAGTGGAGGTGGCAGGG + Intergenic
1080550402 11:33369416-33369438 CAGTAGCAGTGGAGGTGCCAAGG + Intergenic
1080846988 11:36035335-36035357 CTGTGGCGGTGGAGGTGGGCAGG - Intronic
1081674414 11:44960249-44960271 CTGTGAGAGTGGAGGTGGTAAGG + Intergenic
1081744577 11:45463958-45463980 CTGTGGCAGTGGGAGGGATATGG - Intergenic
1082777397 11:57257544-57257566 CTTTTACAGTGGAAGGGGCAAGG - Intergenic
1082941198 11:58707125-58707147 CTGCTTCAGTGGAGGTGGCAGGG - Intronic
1083419146 11:62543780-62543802 CTTGGGCGGTGGCAGTGGCAGGG - Intronic
1083816804 11:65137392-65137414 CACTGGCAGTGAAAATGGCAAGG - Intergenic
1084135454 11:67176437-67176459 ATGTGCCAGTGGTAGTGGTAAGG - Intronic
1084144433 11:67256689-67256711 CTATTGCTTTGGAAGTGGCAAGG - Exonic
1085224626 11:74908347-74908369 ATTTGGCAGTGGAAAGGGCATGG - Intronic
1085266580 11:75241125-75241147 CAGTAGCACTGGAAGGGGCAGGG - Exonic
1085637323 11:78168798-78168820 GTGGGGCGGTGGGAGTGGCAGGG + Intergenic
1085747873 11:79129990-79130012 CTGTTCCAGTGGAGGTGGCAGGG - Intronic
1086825381 11:91489589-91489611 CTGTTCCAGTGGAGGTGGCAGGG + Intergenic
1087615981 11:100487014-100487036 CTGCTCCAGTGGAGGTGGCAGGG - Intergenic
1088239583 11:107759304-107759326 CTGTTCCAGTGGAGGTGGCAGGG - Intergenic
1089163521 11:116457672-116457694 CTGAGGAAGGGGAAGAGGCAGGG + Intergenic
1089494872 11:118902819-118902841 CGGCGGCAGTGGAGGTGGCTGGG + Exonic
1089560668 11:119341591-119341613 CTGTTGCAGTTGAAGGGCCAGGG + Exonic
1089628212 11:119765140-119765162 TGGTGGCAGTGGAGGTGGGAGGG - Intergenic
1089630232 11:119779761-119779783 CTCTGGCAGTGTAAAGGGCAGGG + Intergenic
1091659535 12:2373054-2373076 CTGTGGCGGGAGAAGTGACAAGG + Intronic
1092026936 12:5248685-5248707 CTGTTGCAGTTGAAATTGCATGG - Intergenic
1094362165 12:29641346-29641368 CTGTTCCAGTGGAGGTGGCTGGG - Intronic
1095115337 12:38345166-38345188 CTGTTCCGGTGGAGGTGGCAGGG - Intergenic
1095313795 12:40733487-40733509 CTCTGGCAGGGGAAGGGGGAGGG - Intronic
1095943009 12:47738615-47738637 CTGTGGCCTGGGAAGGGGCAGGG - Intronic
1096347932 12:50866735-50866757 CTGTTCCAGTGGAGATGGCAGGG - Intronic
1096386848 12:51199818-51199840 AGGTGGCAATGGCAGTGGCAGGG + Exonic
1097295541 12:57958489-57958511 CTGTTCCAGTGGAGGTGGCAGGG - Intergenic
1097333490 12:58357087-58357109 CTCTGGCAGAGGAAGTGGTCAGG - Intergenic
1098250158 12:68560805-68560827 CTGTGGCACTGGAGGAGGCTAGG + Intergenic
1098394906 12:70006717-70006739 TTGGGGCAGTGGGTGTGGCATGG - Intergenic
1098500653 12:71187802-71187824 CTGCTCCAGTGGAGGTGGCAGGG - Intronic
1100852377 12:98726594-98726616 GTGTGTCAGCTGAAGTGGCAGGG + Intronic
1101456810 12:104841130-104841152 CTGGGGAAGTGGAAGTGGAGGGG - Intronic
1101903692 12:108810072-108810094 CTGTGGGACAGGAGGTGGCAGGG - Intronic
1102727065 12:115075024-115075046 CAGTGACAGAGGAACTGGCAGGG + Intergenic
1104444592 12:128823323-128823345 CTGGGGCAGGGGAAGAGGCTGGG + Intronic
1104504460 12:129318530-129318552 CTGTTCCAGTGGAGGTGGCAGGG + Intronic
1104548342 12:129732603-129732625 TTGTGGAAGGGGAAGTGGGAGGG - Intronic
1104908663 12:132229061-132229083 CTGTGCCAGTGCATGGGGCAGGG + Intronic
1105314262 13:19242943-19242965 CTGCTTCAGTGGAGGTGGCAGGG - Intergenic
1105332573 13:19431887-19431909 CTCTGGCAGTGGGAGTGGTGAGG + Intronic
1105920725 13:24961162-24961184 CTCTGGCAGTGGGAGTGGTGAGG + Intergenic
1105949825 13:25219644-25219666 ATGAGGCAGTGGAATTGGAATGG - Intergenic
1108120313 13:47178754-47178776 ATGTAGTAGTGGAAGTGACAAGG + Intergenic
1109150693 13:58843834-58843856 CTGCTCCAGTGGAAGTAGCAGGG - Intergenic
1109710575 13:66153418-66153440 CTTAGGAAGTGGAAGTGGAAAGG + Intergenic
1111913103 13:94333776-94333798 CTGTTGCAGTGGAAAGGGAATGG - Intronic
1112945369 13:104920583-104920605 TTGTTCCAGTGGAGGTGGCAGGG - Intergenic
1114414687 14:22533898-22533920 CCATGGCAGTGGAAGTAGAAAGG - Intergenic
1114560783 14:23589042-23589064 CTGTGGGGGTGGAGGTGGGAGGG + Intergenic
1115011799 14:28557300-28557322 GTAGGGCAGAGGAAGTGGCAAGG - Intergenic
1115299302 14:31865900-31865922 CTGTTCCAGTGGAGGTGGCAGGG - Intergenic
1115475073 14:33805714-33805736 CTGGGGCTGAGGAGGTGGCAGGG - Intergenic
1115969858 14:38932880-38932902 CTGTTCCAGTGGAGGTGGCAGGG - Intergenic
1116048986 14:39780909-39780931 CTGTTGCAGTGGAGGTGGCAGGG + Intergenic
1116335592 14:43652034-43652056 CTGTTCCAGTGGAGGTGGCAGGG - Intergenic
1116448668 14:45039897-45039919 CTGTGGCAGGGGAAGTGCGCTGG - Intronic
1117374060 14:55104739-55104761 CTGGGGCTGTGGATTTGGCAAGG + Intergenic
1118316211 14:64727718-64727740 CTGTGACAGTCGCAGTGCCATGG + Exonic
1118350288 14:64968831-64968853 CTGTGGCAGAGCCAGTGGCAGGG + Intronic
1118665018 14:68059172-68059194 CAGTGGCAGTGGAAATGGAAAGG - Intronic
1118812510 14:69285645-69285667 CTGGGGCTGTGGCAGTCGCATGG + Intronic
1119322712 14:73741102-73741124 CTTCGGCAGTGGAAGGGGCAGGG - Intronic
1119668595 14:76501514-76501536 CTGTGCAGATGGAAGTGGCAGGG + Exonic
1120489651 14:85161262-85161284 CTGTTCCGGTGGAGGTGGCAGGG - Intergenic
1121551267 14:94803108-94803130 CTCTGGAAGTGGAGGTTGCAGGG + Intergenic
1122064003 14:99159143-99159165 TTGTGGCAGATGAAGTGGCTGGG + Intergenic
1122313762 14:100813581-100813603 CTGTGGCAGTGGGTCTGGAATGG + Intergenic
1123104176 14:105830277-105830299 CTGTCCCAGTGGAGGTGGCGGGG + Intergenic
1123506240 15:20942757-20942779 CTGTGGCCATGGCAGGGGCAGGG + Intergenic
1124411412 15:29440705-29440727 TGGTGACAGTGGAAGAGGCAGGG - Intronic
1124667957 15:31609825-31609847 CTGTTCCAGTGGAGGTGGCAGGG - Intronic
1124989006 15:34652165-34652187 ATGAGGAAGTGGAAGTGGAATGG + Intergenic
1125050635 15:35294500-35294522 CTGTTGAAGTTGAAGTTGCAAGG - Intronic
1125525488 15:40371471-40371493 CTGTGGCTGTAGAAGAGGCACGG - Intergenic
1125827691 15:42690262-42690284 ATCTGGCAGTGGAATTGGCCTGG - Exonic
1126094473 15:45078216-45078238 CTGTGGCAGTGGGAATGGATAGG - Intergenic
1127036436 15:54923537-54923559 CTGCTCCAGTGGAGGTGGCAGGG + Intergenic
1128391794 15:67187319-67187341 CTGTGGGGATGGAAGTGGCCAGG - Intronic
1129097552 15:73225190-73225212 CTGTTCCAGTGGAGGTGGCAGGG + Intronic
1129210308 15:74064509-74064531 CTGTGGCAGGGGAGGTGGGTGGG - Intergenic
1129403714 15:75300893-75300915 CTGTGGCAGGGGAGGTGGGTGGG + Intergenic
1129783846 15:78294453-78294475 GTGCAGCAGTGGCAGTGGCAGGG - Intronic
1130333404 15:82938770-82938792 CTGTGGGAGTGGGAGTGTTAGGG - Intronic
1130745809 15:86652826-86652848 CTCTGGCAGGGGAAGTGAAAAGG - Intronic
1131438285 15:92439990-92440012 TTGTGACAATGGAAGAGGCATGG - Intronic
1132210235 15:100016751-100016773 CTGTTCCAGTGTAGGTGGCAGGG + Intronic
1132303052 15:100788263-100788285 CTGCTGCAGGGGAAGTAGCAGGG - Intergenic
1202971824 15_KI270727v1_random:243598-243620 CTGTGGCCATGGCAGGGGCAGGG + Intergenic
1132552397 16:558984-559006 CTGTGTCAGGGAAGGTGGCATGG + Intergenic
1132691050 16:1182113-1182135 CTGTGGCAGGGGCAGGAGCAGGG + Intronic
1132849698 16:2019529-2019551 CTCTAGGAGTGGAAGTGCCAGGG - Exonic
1135901645 16:26465176-26465198 CAGTGGAGGTGGAGGTGGCAGGG - Intergenic
1135906150 16:26513643-26513665 CTTAGGAACTGGAAGTGGCAGGG + Intergenic
1137032057 16:35532761-35532783 CTGTGGCAGAGGAAGTTCCCAGG + Intergenic
1137468823 16:48736172-48736194 CTGTGGCAGAGGAAAAGGCATGG + Intergenic
1137537950 16:49341824-49341846 CTCTGGCAGAGGGAGTGGCAGGG + Intergenic
1138265357 16:55656288-55656310 CTGTGGCTGTTGAAGTGTCGCGG + Intronic
1138530594 16:57632237-57632259 ATTTGGCAGTGGCAGGGGCAGGG - Intronic
1138657169 16:58498223-58498245 CTGTGGCACAGGAAGAGGCTTGG - Intronic
1138881074 16:61015154-61015176 CTATTTCAGTGGAGGTGGCAGGG - Intergenic
1139004874 16:62558444-62558466 CTGGGGCAGTGGTAGTGACAGGG - Intergenic
1139361934 16:66405264-66405286 CTGAGGCAGTGATAGTGGCTGGG - Intergenic
1139404371 16:66706590-66706612 CCATGGCAGAGGAAGTGGCATGG + Intergenic
1140093075 16:71852952-71852974 GTTTGGCAGTGGAAGTGGAGGGG - Exonic
1140306778 16:73810149-73810171 CAGTGGAAGTGGAGGTGGCGGGG - Intergenic
1140487979 16:75309268-75309290 TTGTGGCAGAGAAAGCGGCAAGG - Intronic
1141505187 16:84472243-84472265 TAGTGGCAGTGGCAATGGCAGGG - Intergenic
1141886782 16:86897687-86897709 CTGTGGCTGTGGCAGTGACCTGG - Intergenic
1142204740 16:88777568-88777590 CTGAGGCAGGGGCAGTGGGATGG + Intronic
1142450999 16:90173104-90173126 CTGGGGCAGAGGCAGTGGCAGGG + Intergenic
1142456564 17:60591-60613 CTGGGGCAGAGGCAGTGGCAGGG - Intergenic
1142675973 17:1513598-1513620 CTGTGGCAGGGGAAGTAGCCTGG - Intronic
1143254193 17:5543684-5543706 CTGAGGAAGTGGAGGTGGCTGGG + Intronic
1143280657 17:5751940-5751962 TGGTGGCAGTGGGAGAGGCAGGG + Intergenic
1143614652 17:8042620-8042642 CTGTGGGATTGGTAGTGGGAAGG - Intronic
1143990884 17:10960192-10960214 CTCTTCCAGTGGAGGTGGCAGGG - Intergenic
1144409647 17:14988171-14988193 GTGTGGCAGTGGAAATGGAAAGG + Intergenic
1144682880 17:17206729-17206751 CTGTGGCAGGGGGCGTGGCCTGG - Intronic
1144783142 17:17817728-17817750 CGGTGGCAGTGGCAGTGACTCGG - Exonic
1145182274 17:20763814-20763836 CTCTTGCTGTGGCAGTGGCATGG - Intergenic
1146281600 17:31548858-31548880 ATTTGGCAGTGGTGGTGGCAGGG + Intergenic
1146559686 17:33857414-33857436 CTGTGACAGAGGAAAAGGCAGGG - Intronic
1146681742 17:34813304-34813326 CTGGGCCTGGGGAAGTGGCAGGG + Intergenic
1146748568 17:35354483-35354505 CTGTGGCAGTGGAGGAGGGGGGG - Intronic
1147502197 17:40976317-40976339 CAGTGTCAGTGGAAGCTGCATGG - Intergenic
1147586299 17:41655586-41655608 CTGGGGGAGGGGACGTGGCAGGG - Intergenic
1147651343 17:42063699-42063721 CTGAGGGAGAGGCAGTGGCAAGG + Intronic
1147654099 17:42078723-42078745 CTGGGGCAGAGGCAGGGGCATGG + Intergenic
1147888870 17:43703148-43703170 CTGTGGCCATGGAAGCTGCAAGG - Intergenic
1148317671 17:46717752-46717774 TGGTGGCAGTGGCGGTGGCAGGG + Intronic
1148476920 17:47934849-47934871 CTGAGGTGGTGCAAGTGGCAAGG - Intergenic
1149127656 17:53254868-53254890 CAGTGGTGGTGGCAGTGGCATGG - Intergenic
1149307117 17:55358671-55358693 CTTTGGGAGGCGAAGTGGCAGGG + Intergenic
1149599133 17:57881968-57881990 TTGTGGCGGTGGCAGTGGGAGGG - Intronic
1150072527 17:62163960-62163982 CTGTGGTAGGTGAAGGGGCAAGG - Intergenic
1150483604 17:65529231-65529253 CTGTTGCAGAGGGAGAGGCAGGG - Exonic
1151017615 17:70575404-70575426 CTCTGGCACTGAAAGTTGCAGGG + Intergenic
1151048462 17:70948530-70948552 CTGTTCCAGTGGAGGTGGCCGGG - Intergenic
1151279881 17:73065502-73065524 CTGTGGAATTGGAAGAGGCAGGG - Intronic
1151774895 17:76193896-76193918 CTGTGGATGTGGAGGTGGGAGGG - Intronic
1153164334 18:2244706-2244728 CTGCTCCAGTGGAGGTGGCAGGG - Intergenic
1153396332 18:4625581-4625603 CTGCTCCAGTGGAGGTGGCAGGG + Intergenic
1153969776 18:10215656-10215678 CTCTGGGAGAGGAAGTGGCCTGG - Intergenic
1156232900 18:35172236-35172258 CTGGGGCAGTGGCAGGAGCATGG - Intergenic
1156579002 18:38353746-38353768 TTGCTGCAGTGGCAGTGGCATGG + Intergenic
1157153111 18:45239262-45239284 CAGTGGCAGTGGGATTGGAATGG - Intronic
1157218649 18:45807483-45807505 CTGTTCTAGTGGAGGTGGCAGGG - Intergenic
1157524594 18:48371335-48371357 CTGTGGAACTGGAAATGTCAGGG + Intronic
1159324423 18:66895883-66895905 CTGTGACAGTGGAGCTGGCCAGG - Intergenic
1159395196 18:67846878-67846900 CAGTGGCAGTGCATGGGGCAGGG - Intergenic
1159787134 18:72727463-72727485 CTGTTTCTGTGGAGGTGGCAGGG - Intergenic
1159906603 18:74097867-74097889 CTGTTCCAGTGGAGGTGGCAAGG - Intronic
1160646482 19:195944-195966 CTGGGGCAGAGGCAGTGGCAGGG - Intergenic
1160814041 19:1027159-1027181 CTTTGGGAGGGGAAGGGGCATGG + Intronic
1161962963 19:7533015-7533037 CGGTGACATTGGATGTGGCAGGG - Intronic
1162945255 19:14039528-14039550 CTGTGGCAGTGGCAGCCGGACGG + Exonic
1163604287 19:18265650-18265672 GTGTGGCAGTGGAAATGGCTGGG - Exonic
1164108048 19:22126038-22126060 CTGCTTCAGTGGAGGTGGCAGGG - Intergenic
1164273749 19:23698907-23698929 CTGCTTCAGTGGAGGTGGCAGGG + Intergenic
1165266369 19:34665893-34665915 CTGTAGCTGTGCAAGTGGGAAGG + Intronic
1165846200 19:38819290-38819312 CTGTGGCTGTTGAAGAGGGAGGG - Intronic
1166274849 19:41746012-41746034 CGGTGGTAGTGGTGGTGGCATGG - Intronic
1166279886 19:41784919-41784941 CGGTGGTAGTGGTGGTGGCATGG - Intergenic
1168022515 19:53619962-53619984 CTGTGACAGGGGATGAGGCAGGG - Intergenic
1168163191 19:54526649-54526671 CTCTGGAAGTGGCATTGGCAAGG - Intergenic
925006184 2:444797-444819 TTCTGCCAGTGGAAGAGGCAGGG - Intergenic
925069603 2:956195-956217 CAGGGGCAGGGGCAGTGGCAGGG - Intronic
925430051 2:3783683-3783705 GTGTGGCAGTGGAGGTAGCGTGG + Intronic
925629963 2:5882061-5882083 CTTTTGCAGAGGAAGTTGCAGGG - Intergenic
926703504 2:15819891-15819913 CTGGGGCTGTGGGAGGGGCAAGG + Intergenic
927153476 2:20208930-20208952 CTGTGGGTGGGGAAGGGGCAAGG - Intronic
927292631 2:21419911-21419933 CTGCGGCAGGGGAAGGGACAAGG + Intergenic
927328291 2:21832221-21832243 CTGTTCCGGTGGAGGTGGCAGGG + Intergenic
928443179 2:31310947-31310969 CTGCTCCAGTGGAGGTGGCAGGG + Intergenic
928780808 2:34818181-34818203 CTGTGGCAGGGGAGGGAGCAAGG - Intergenic
928949984 2:36805903-36805925 CTGGGGCTGTGGAAGGAGCAAGG - Intronic
930486455 2:52017521-52017543 CTGTTTCAGTGGAGGTGGCAGGG + Intergenic
930774540 2:55159273-55159295 CAGTGGAAGTGGAGGGGGCAAGG - Intergenic
931136937 2:59413953-59413975 CTGCTCCAGTGGAGGTGGCAGGG + Intergenic
931525166 2:63145143-63145165 CTGTTCCAGTGGAGATGGCAGGG + Intronic
932544064 2:72688528-72688550 CTGGGGCAGGGGCAGGGGCAGGG + Intronic
932594382 2:73085173-73085195 CTGTGGCAGCGGAAGGAGCTTGG - Intronic
932662966 2:73672937-73672959 CTGTGGGAGCGGAACTGGCAGGG + Intergenic
932664486 2:73685903-73685925 CAGTGGCAGTGGATGAGGCCAGG - Intergenic
932763953 2:74458524-74458546 CGGTGGCAGCAGAGGTGGCAGGG + Exonic
933121410 2:78542291-78542313 CTGTTCCAGTGGAGGTGGCAGGG - Intergenic
933909987 2:86930811-86930833 CAGTGGCAGCAGAGGTGGCAGGG - Intronic
934022738 2:87972577-87972599 CAGTGGCAGCAGAGGTGGCAGGG + Intergenic
934557846 2:95296875-95296897 CTGTGGAAGTGGAAAAGGAAGGG - Intergenic
934558621 2:95300716-95300738 CTGTGGCAGGGAAAGAAGCAAGG + Intronic
935644115 2:105318891-105318913 ATGTGGCCCTGGAAGTGGAAGGG - Intronic
935949674 2:108317265-108317287 CTGCAGGGGTGGAAGTGGCAGGG - Intergenic
936451068 2:112634478-112634500 CTGGGGCAGTGGGAGGGGTAGGG + Intergenic
937019032 2:118633578-118633600 CTGTGGCAGTGGGCCGGGCAGGG - Intergenic
937060395 2:118976522-118976544 CTGGGGCAGGGGCAGGGGCAGGG - Intronic
937242656 2:120472327-120472349 CTGTGGCAGGGGAAGAGAAAAGG - Intergenic
937338672 2:121077184-121077206 CTGTGGCCGCGGAAGGGGCCGGG + Intergenic
937527966 2:122794324-122794346 CTGAGGGTGTGGGAGTGGCAGGG + Intergenic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
937699384 2:124846958-124846980 CTGCTGCAGTGGAGGTAGCAGGG + Intronic
937762900 2:125627386-125627408 CTGTTGCAGGGGAGGGGGCAAGG + Intergenic
937781932 2:125848564-125848586 CTGTTCCAATGGATGTGGCAGGG + Intergenic
937828897 2:126399088-126399110 TTGTTCCAGTGGAGGTGGCAGGG + Intergenic
938693709 2:133815855-133815877 CAGTAGCAGTGGCAGTAGCAGGG - Intergenic
938889812 2:135692798-135692820 CTGTGGTAGTGGCAGTAGGAGGG + Intronic
939405009 2:141745415-141745437 CTCTGCCAGTGGAAGGGGGAGGG - Intronic
940709343 2:157143711-157143733 CTGTTCCAGTGGAGGTGGCAGGG + Intergenic
940985699 2:160049953-160049975 CTGTGGCAGGGGCAGGGGAAGGG + Intronic
941042482 2:160638237-160638259 CTCAGGTAGTGGAAATGGCATGG - Intergenic
941140416 2:161773966-161773988 CAGTGGCAGTGGGAATGGAAGGG - Intronic
941718389 2:168787360-168787382 CTGTGGCAGTGTAAGCAGTATGG - Intronic
942422175 2:175819726-175819748 CTGTCGCAGGTGAGGTGGCAGGG - Intergenic
943101870 2:183496621-183496643 CAGGGGTAGTGGAAGTGGAATGG + Intergenic
943992338 2:194712854-194712876 CTGTGGCAATGAAAGATGCAAGG - Intergenic
944155613 2:196604270-196604292 CTGGGGCAGTGGAAGGGGCATGG - Intergenic
944303251 2:198149100-198149122 TTCTGGGAGTGGAGGTGGCAAGG + Intronic
944838034 2:203598907-203598929 CAGTGGCAGTGGCAGTGGCATGG - Intergenic
946682222 2:222229553-222229575 TAGTGGCAGTGGGAATGGCAAGG - Intronic
946752806 2:222909542-222909564 CTTTGGCTGTGGCAGTTGCATGG + Intronic
946758761 2:222972628-222972650 CTGGGGCAGGTGAAGGGGCAGGG + Intergenic
947204875 2:227651287-227651309 CTGTGGCCGTGGAAGAGAGAAGG + Intergenic
947538197 2:230954221-230954243 CTGTGTCAGGGGAAGGGGCAAGG - Intronic
947757750 2:232580404-232580426 ATGGGGCAGTGGAGGTGGAAGGG - Intronic
948612911 2:239180954-239180976 CCATGGCAGCGGAAGTGGCCTGG + Intronic
948646479 2:239408175-239408197 CTGTGGGAGTGGCATTGGCAGGG + Intergenic
948815388 2:240507725-240507747 CTCTGTCAGGGGAAGTGACATGG - Intronic
1168935449 20:1661529-1661551 TGGTAGCAGAGGAAGTGGCAGGG + Intergenic
1168974066 20:1951031-1951053 CTGTGGCAGTGACATGGGCAGGG + Intergenic
1169274452 20:4224272-4224294 CTGTTCCAGTGGAAGTGGTCAGG + Intronic
1169652487 20:7884961-7884983 CGGTGGCAGTGGAGATGACAGGG + Intronic
1169842168 20:9951564-9951586 TAGTAGCAGTGGAAGTGGTATGG - Intergenic
1170083698 20:12505556-12505578 CTGTAGCAGTGGAAGTAGGAGGG + Intergenic
1170168235 20:13383307-13383329 TTGTAGCAGTGGAGGTGGTAAGG + Intergenic
1170498261 20:16948044-16948066 CGGTGGCAGTGGAAGAGATAAGG - Intergenic
1170756672 20:19212063-19212085 CTGTGCCAGGGGAAGAGGGACGG - Intergenic
1171198481 20:23222492-23222514 CTGTTTCAGTGGAGGTGGCAAGG + Intergenic
1172102713 20:32495179-32495201 CTGTGGCTGAGGAAGTGCCCAGG - Intronic
1172425137 20:34850997-34851019 CGGTTGCAGGGGAAATGGCAGGG - Intronic
1172656787 20:36542567-36542589 CTGTGGCAGTGGAGTGGGAAAGG - Intronic
1172881044 20:38200174-38200196 CTGCCTCAGTGGAAGAGGCAGGG - Intergenic
1173568413 20:44058650-44058672 CTGGTCCAGTGGAAGTAGCAGGG - Intronic
1173583864 20:44166946-44166968 ATGAGGCAGGGGAGGTGGCAGGG - Intronic
1174098189 20:48106265-48106287 CTGAGGCCCTGGAAGAGGCAAGG - Intergenic
1175920986 20:62450637-62450659 CTGGGACATTGGAAGTGGGAGGG - Intergenic
1175943201 20:62547334-62547356 CTGGGGCAGTGGCAGTGGATGGG - Intergenic
1176279025 20:64290272-64290294 CTGGGGCAGAGGCAGTGGCAGGG + Intergenic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1177073588 21:16543583-16543605 CTGTGGGAATGAAAGTGGCAAGG - Intergenic
1177276250 21:18916571-18916593 CTGTGGCAGTAGAGGTTGGATGG - Intergenic
1178718133 21:34985427-34985449 CTGTAGGAGTGGAATAGGCAGGG + Intronic
1178801732 21:35801671-35801693 CTGTTCCAGTGGAGGTGGCAGGG - Intronic
1178959090 21:37047617-37047639 CTGTTCCAGTGGAGGTGGCAGGG - Intergenic
1180072131 21:45441870-45441892 CCGTGGCCTTGGGAGTGGCATGG - Intronic
1180250753 21:46585819-46585841 CTGTTCCAGTGGAGGTGGCAGGG - Intergenic
1181031445 22:20150351-20150373 CTGGGGCAGGGGCAGGGGCAGGG + Intronic
1181277682 22:21696862-21696884 CTGTGGCAGTGGATGGGGTGAGG - Exonic
1181634830 22:24169686-24169708 CTGGGCCAGTGGAGGAGGCAGGG - Intronic
1182080719 22:27526904-27526926 CTGTGGCAGTGGCAGTGGGTGGG - Intergenic
1182088918 22:27580856-27580878 CAGTGACAGTGGTAGTGGTAAGG - Intergenic
1182447376 22:30397498-30397520 CTGGGGCAGGGGCAGGGGCAGGG + Intronic
1183465352 22:37977684-37977706 CGGTGCCAGGGGAAGTGGCTGGG - Intronic
1183535982 22:38401706-38401728 CTGTGGGACTGGAAGGGGCCTGG + Intergenic
1183778000 22:39980505-39980527 CTGTGGCGGGGGGAATGGCAGGG - Intergenic
1183964325 22:41432118-41432140 TGGTGGCAGTAGAGGTGGCAAGG + Intergenic
1184390563 22:44200998-44201020 CTGTGGCTGTGGCTGTGGCTGGG - Intronic
1184537966 22:45100290-45100312 CTGTGCCAGAGGAGGAGGCATGG + Intergenic
1184839134 22:47042341-47042363 CTGTGGCAGTGGGGGCGCCATGG + Intronic
1184982934 22:48107073-48107095 CTGGGGCAGAAGAAATGGCAAGG - Intergenic
1185391405 22:50563273-50563295 CTGTGACAGTGGAAATAGCTGGG - Intergenic
949574244 3:5323299-5323321 CTGTGTCAGTGTACATGGCAAGG + Intergenic
950442935 3:13020249-13020271 CTGGGGCAGGGGCAGGGGCAGGG + Intronic
950542128 3:13618979-13619001 CTGCGGCAGTGGCAGCGGGATGG - Exonic
950883527 3:16343295-16343317 CTTTAGCAGAGGAAGTGGCTGGG - Intronic
951140305 3:19150218-19150240 GTGTGGTAGTGGCAATGGCAGGG - Intronic
951596100 3:24319866-24319888 ATGTTCCAGTGGAACTGGCATGG + Intronic
952045638 3:29315848-29315870 CTGTGTCAGTGATAGTGGTAGGG - Intronic
952773380 3:37022050-37022072 TTCTGGCAGAGGAAATGGCAAGG + Intronic
952866266 3:37857248-37857270 CTGAGGTAGTGCAAGAGGCAGGG - Intergenic
953974499 3:47371811-47371833 CTGTGGCAGGAGAAGTGGGGAGG - Intergenic
954345832 3:49998441-49998463 CTGAGGCAGTGGAGGAAGCATGG + Intronic
954579621 3:51696237-51696259 CTGTGGAAGGGGATGTGCCAGGG + Intronic
954725134 3:52601802-52601824 CTTGGGCAGTGGATGTGGCAAGG + Intronic
956018056 3:64905046-64905068 CTGTGGAAGTCAAAGTGGAAAGG + Intergenic
956447648 3:69341485-69341507 CTGCAGGAGTGGAGGTGGCAAGG + Intronic
956950317 3:74274407-74274429 CTGTTCCAGTGGAGGTGGCGGGG - Intronic
958018644 3:87971009-87971031 CTGTGGAAGGGGAGGAGGCAGGG - Intergenic
958539291 3:95449630-95449652 CTGTAGCAGTGGAATTGCTAAGG - Intergenic
958647042 3:96887472-96887494 CTGTTCCAGTGGAGGTGGCCAGG + Intronic
958969892 3:100600356-100600378 CTGTTCTGGTGGAAGTGGCAGGG + Intergenic
959436183 3:106317650-106317672 CTGTTCCAGTGAAGGTGGCAGGG - Intergenic
959950355 3:112174483-112174505 CTGTGGCAGTGGAGGGAGCGGGG + Intronic
960348511 3:116564958-116564980 CTGGGTCAGGGGGAGTGGCAAGG - Intronic
961427743 3:126861495-126861517 CGGTGGCAGTGGCAGGGGCAGGG - Intronic
961427746 3:126861501-126861523 TGGTGGCGGTGGCAGTGGCAGGG - Intronic
961492475 3:127265147-127265169 CAGTGGCAGAGGGAGCGGCAGGG + Intergenic
961577985 3:127854114-127854136 CTCTGGCAGTAGAGGTGACAAGG + Intergenic
961906668 3:130269883-130269905 CTGGGGCAGGGGCAGGGGCAGGG - Intergenic
961978035 3:131047661-131047683 CTGCTCCAGTGGAGGTGGCAGGG + Intronic
962343338 3:134602828-134602850 CTGTGGCTGTGCAGGTGGGAGGG - Intronic
963065789 3:141263236-141263258 CTGTGGAAGTGGAGGTAGTAAGG + Intronic
963771752 3:149393302-149393324 CTCTGGCAGAGGAAGTAGCATGG - Intergenic
965060981 3:163785969-163785991 CTGCTCCAGTGGAGGTGGCAGGG + Intergenic
965847576 3:172982258-172982280 CTTTTGTAGTGAAAGTGGCATGG + Intronic
966278616 3:178205118-178205140 GAATGGCAGTGGCAGTGGCAGGG + Intergenic
967422878 3:189293288-189293310 GTGTGACAGCGGAAGTGGGAGGG - Intronic
967635818 3:191801679-191801701 CTGTGGCAGTAGAAGTTGGGTGG - Intergenic
968371199 3:198223582-198223604 CTGGGGCAGAGGCAGTGGCAGGG + Intergenic
968529807 4:1085626-1085648 CTGAGGCAGTGGGAGGGGCCTGG - Intronic
968687510 4:1971274-1971296 CTGTGTCACTGAAAGTGGTAGGG - Intronic
968793664 4:2687639-2687661 CAATGGCAGTGAAGGTGGCAAGG - Intronic
968913889 4:3488839-3488861 CTGTGGATGTGGAAGGGGCAGGG + Intronic
968929816 4:3572920-3572942 CTGTGGCACTGCAGGTCGCAAGG + Intergenic
969472273 4:7395952-7395974 CTGTGGCAAAGGGAGTGCCAGGG - Intronic
969503634 4:7570371-7570393 CTCTGGCAGCGGGAGTGGGAGGG - Intronic
969574247 4:8027341-8027363 CTGGGGCTGTGGAAGAGTCAGGG + Intronic
969665970 4:8557855-8557877 CCGTGGCAGAGGGAGCGGCAGGG - Intergenic
969708808 4:8831082-8831104 CTGTGGCAGAGGATGTGGTCAGG - Intergenic
972110830 4:35557209-35557231 CTGTGGAAGTGGAAGTGGTATGG - Intergenic
972189023 4:36568328-36568350 CTGTTCCGGTGGAGGTGGCAGGG + Intergenic
973122968 4:46545619-46545641 CTGTGACAGTAGAAGAGGCCAGG - Intergenic
973179525 4:47251332-47251354 CTGTTCCAGTGGAGGTGGCAGGG + Intronic
973741630 4:53924602-53924624 CTGGCTCAGTGGAGGTGGCAAGG - Intronic
974094795 4:57351334-57351356 CATTGGCAGTGGCAGTGGCAGGG + Intergenic
974474392 4:62361284-62361306 CTGTTCCAGTGGAGGTGGCATGG + Intergenic
974478854 4:62419426-62419448 GAGTGGAAGTGGAAATGGCAAGG - Intergenic
975732367 4:77350144-77350166 CTGTAGCAGGGGGAGTGGCATGG + Intronic
976369149 4:84267059-84267081 CTGTGGCAGGGGAGATTGCATGG + Intergenic
977019942 4:91746588-91746610 CTGTTCCAGTGGAGGTAGCAGGG + Intergenic
977220017 4:94327440-94327462 CAGTGGCAGTGGTAGTGGGTGGG + Intronic
977826138 4:101533859-101533881 CTGCTCCAGTGGAGGTGGCAGGG - Intronic
977929838 4:102738355-102738377 CTGCTCCAGTGGAGGTGGCAGGG - Intronic
979259883 4:118636055-118636077 CTGGGGCAGAGGCAGTGGCAGGG + Intergenic
979328500 4:119404570-119404592 CTGGGGCAGAGGCAGGGGCAAGG - Intergenic
979955910 4:126954025-126954047 CTCATACAGTGGAAGTGGCAGGG - Intergenic
980165701 4:129224370-129224392 ATGTGACACTGGAGGTGGCATGG - Intergenic
980237876 4:130131927-130131949 TTGTTCCAGTGGAAGTTGCAGGG - Intergenic
981457568 4:144971756-144971778 GTGTGGCAGTGGAAGTGGCAAGG - Intronic
982134401 4:152259497-152259519 CTGTGGCAGGGGGAGGGGCATGG - Intergenic
982491795 4:156038988-156039010 CTGTTCCGGTGGAGGTGGCATGG - Intergenic
983944978 4:173575971-173575993 CTGTTGCAGTGGAATTGGGCCGG + Intergenic
985548368 5:521056-521078 CTTTAGCAGTGGAGGCGGCAGGG - Intronic
985676639 5:1234841-1234863 CTGTGGCATGGGCAGTGGCCCGG + Intronic
985790838 5:1926249-1926271 CTGTGGCATTGGCAGGGGCTGGG - Intergenic
985790846 5:1926273-1926295 CTGGGGCTGTGGCAGGGGCAGGG - Intergenic
986307553 5:6526817-6526839 AAGTGGCAGTAGAGGTGGCAAGG - Intergenic
986674126 5:10168606-10168628 CTGTGCCAGTGGCAGGGGCGAGG - Intergenic
986870284 5:12037070-12037092 CTGTTCCAGTGGAGGTGGCAGGG - Intergenic
987413866 5:17642661-17642683 CTCTGGAGGTGGAAGTTGCAGGG - Intergenic
988493262 5:31722976-31722998 CTGTGGCAGTGGGCCAGGCACGG - Intronic
988723504 5:33903054-33903076 CTGTTCCGGTGGAGGTGGCAGGG + Intergenic
989098420 5:37802378-37802400 CTGTGGAAGTAGAAAAGGCAAGG - Intergenic
990390466 5:55314557-55314579 CTCTAGAAGTGGAAGTGGCAAGG + Intronic
990522785 5:56595750-56595772 CTGTGGCTGTGGAAATAGCCTGG + Intronic
990539107 5:56754578-56754600 CTGTGGTAGTAGAAAAGGCAGGG + Intergenic
990547378 5:56836360-56836382 GTGTGGCAGTGCACGTGGGAAGG + Intronic
992414631 5:76540474-76540496 AAGTGGCAGTGGTAGTGGGAAGG + Intronic
993250284 5:85512990-85513012 CTGTTCCCGTGGAGGTGGCAGGG + Intergenic
993883833 5:93394480-93394502 CTGTTCCAGTGGAGGTGACAGGG + Intergenic
993964819 5:94347406-94347428 CTGTTCCGGTGGAAGTGGCAGGG - Intronic
994222130 5:97208417-97208439 CTGTTTCGGTGGAGGTGGCAGGG + Intergenic
994875360 5:105414251-105414273 CTGTTCCAGTGGAGGTGGCAGGG - Intergenic
994887509 5:105583173-105583195 ATGCTCCAGTGGAAGTGGCAGGG - Intergenic
995540244 5:113178712-113178734 CTTTGACAGTGGAAGTGGAATGG - Intronic
997492286 5:134287592-134287614 TTATGGCAATGGCAGTGGCAGGG - Intronic
997760975 5:136446828-136446850 CTGTTCCAGTGGAGGTGGCAGGG - Intergenic
998160566 5:139810717-139810739 CTGTGGCACTGGGTGTGCCATGG + Intronic
998208493 5:140175948-140175970 CGGTAGCAGTGGAGGTTGCAGGG + Intronic
998480372 5:142458289-142458311 CTGTGACAGTGGAAAGGGGAGGG - Intergenic
999500088 5:152138198-152138220 CTGATGGAGTGGAAGGGGCAGGG - Intergenic
999818560 5:155201279-155201301 CTGTTCCAGTGCAGGTGGCAGGG - Intergenic
999864381 5:155684714-155684736 CAGTGGCACTGGGACTGGCAGGG + Intergenic
999973321 5:156886730-156886752 GTGTGGCGGTGGAAGTGGGGAGG - Intergenic
1000386264 5:160677292-160677314 GTGAGGCAGTGGGAGTAGCATGG + Intronic
1000779699 5:165465285-165465307 CTGTTCCAGTGGAGGTGGCAGGG - Intergenic
1000965633 5:167652735-167652757 CTGTGGCAGTAGAAATGCAAAGG - Intronic
1001364575 5:171123464-171123486 CAGTGGCAGTAGCAGTGGAAGGG - Intronic
1001797146 5:174511859-174511881 CTGTTGCTGTGGAATGGGCATGG + Intergenic
1002405298 5:179025535-179025557 CTCTGGTAGTGGCAGTGGCCTGG - Intronic
1002500946 5:179647297-179647319 CTCTGGGAAGGGAAGTGGCATGG + Intergenic
1002730438 5:181329128-181329150 CTGGGGCAGAGGCAGTGGCAGGG + Intergenic
1002754094 6:144976-144998 CTGGGGCAGAGGCAGTGGCAGGG - Intergenic
1002989906 6:2228890-2228912 ATGGGGCAATGGAAGTGGCCAGG + Intronic
1003582003 6:7348179-7348201 CTGTTCCCGTGGACGTGGCAGGG - Intronic
1004884118 6:20035671-20035693 CTGAGTCTGTGGATGTGGCAAGG - Intergenic
1004888586 6:20075189-20075211 CTGCTTCAGTGGAGGTGGCAGGG - Intergenic
1005624725 6:27652902-27652924 CAGTGGCAGAGGCAGAGGCAGGG - Intergenic
1005760320 6:28961527-28961549 CTGTTCCAGTGGAGGTGGCAGGG - Intergenic
1005798186 6:29390759-29390781 CTTTGGCAGTGGATGTGGTGTGG + Intronic
1006060299 6:31414138-31414160 CTGTGGCAGTGGCAGTTCCCAGG + Intronic
1008250844 6:49238045-49238067 CTGCTCCAGTGGAGGTGGCAGGG + Intergenic
1008250860 6:49238127-49238149 CTGCTCCAGTGGAGGTGGCAGGG + Intergenic
1008290070 6:49704732-49704754 CTGTTCCAGTGGAGGTAGCAGGG + Intronic
1008528563 6:52433563-52433585 CTGCTCCAGTGGAGGTGGCAGGG + Intronic
1008973896 6:57401940-57401962 CTGCTGCAGAGGCAGTGGCAGGG + Intronic
1009162786 6:60303445-60303467 CTGCTGCAGAGGCAGTGGCAGGG + Intergenic
1009408768 6:63341237-63341259 CAGTGGCAGTGGCAGTGGGCAGG + Intergenic
1009796570 6:68476893-68476915 CTGGGGAAGGAGAAGTGGCAAGG - Intergenic
1009798564 6:68503199-68503221 CTGTTTTAGTGGAAGTGGCAGGG - Intergenic
1010679381 6:78781546-78781568 CTGTTTCAGTGGAGGTGGCTGGG - Intergenic
1011133089 6:84072461-84072483 CTGTTCCAGTGGAGGTGGTAGGG + Intronic
1011319931 6:86080213-86080235 CTGCTCCAGTGGAAGTGGCAGGG + Intergenic
1011366073 6:86584261-86584283 CTGCTCCAGTGGAGGTGGCAGGG + Intergenic
1012253652 6:97008128-97008150 TTGTGCCAGTGGTGGTGGCATGG + Intronic
1012336474 6:98065397-98065419 CGCTGGAAGTGGAAGTGGGATGG - Intergenic
1012965682 6:105670158-105670180 CTGCTCCAGTGGAGGTGGCAAGG - Intergenic
1013152547 6:107459948-107459970 CAGTGGCAGTGGCCGTGGCCGGG + Intergenic
1013419071 6:109949841-109949863 CTGGGACAGTGGGAGTGGCACGG - Intergenic
1013856729 6:114581571-114581593 CTGCTCCAGTGGATGTGGCAGGG - Intergenic
1015122189 6:129711809-129711831 CTATGGAAGTGGAAATGGGAAGG - Intergenic
1015362311 6:132354540-132354562 CTGTTCCAGTGGAGGTGGCAGGG + Intronic
1015849736 6:137559850-137559872 CTATTCCAGTGGAGGTGGCAGGG + Intergenic
1015899920 6:138053720-138053742 CTGCAGCAGTGGAGGTAGCAGGG - Intergenic
1017743694 6:157428280-157428302 CTATGGCAGAGGAGCTGGCAAGG - Intronic
1017769938 6:157637194-157637216 CTGTGGCTTTGGAGGTGGCATGG + Intronic
1018009461 6:159656043-159656065 CTGTTCCAGTGGAGGTGGCAGGG - Intergenic
1018344311 6:162884933-162884955 CTGTTTAAGTGTAAGTGGCATGG - Intronic
1019063688 6:169277139-169277161 TTGTGGCAGTGTAAGTGGCAAGG - Intergenic
1019331979 7:464783-464805 CTGGGGCAGAGGGAGTGGCTTGG - Intergenic
1020457996 7:8396121-8396143 CTGTGGCAGTTGAAGGTTCAAGG + Intergenic
1020634952 7:10685300-10685322 CTGTTCCAGTGGAGGTGGCAGGG - Intergenic
1021299704 7:18957529-18957551 CTTTGGCAGAGAAAGTGGTAGGG + Intronic
1021424809 7:20487296-20487318 TTGTGGCAGTGGAAATGGGTGGG - Intergenic
1021848814 7:24788186-24788208 CTGGGGCAGGGGAAGAGCCAGGG - Intergenic
1023401602 7:39795679-39795701 CTGGGGCAGAGGCAGTGGCAGGG + Intergenic
1023844081 7:44111431-44111453 CCCTGGAAGTGGAAGGGGCATGG + Intronic
1024075583 7:45816301-45816323 CTGGGGCAGAGGCAGTGGCAGGG + Intergenic
1024109376 7:46129892-46129914 CAGTGGCAGGGGAAATGGAAGGG + Intergenic
1024117828 7:46209854-46209876 CTGTGGCAGTGGGAGAGAAAGGG - Intergenic
1024150812 7:46569584-46569606 CAGGGGCAGTGCAGGTGGCAGGG + Intergenic
1024178522 7:46864255-46864277 CTGTGTCAGTGGAGGTCTCATGG + Intergenic
1024324277 7:48096515-48096537 CTGGGGAAGGGGAAGTGGGAGGG - Intronic
1024548083 7:50538986-50539008 CTGGGGCACTGGAAGTTGCCGGG - Intronic
1024648016 7:51384996-51385018 CTGGGGCAGAGGCAGTGGCAGGG - Intergenic
1024750165 7:52455752-52455774 CCAGGGCAGCGGAAGTGGCAGGG - Intergenic
1024840073 7:53575223-53575245 CTGCTCCAGTGGAGGTGGCAGGG - Intergenic
1024917177 7:54514950-54514972 CTGTTCCAGTGGAGGTGGCAGGG + Intergenic
1025051870 7:55739492-55739514 CTGGGGCAGAGGCAGTGGCAGGG - Intergenic
1025128828 7:56365160-56365182 CTGGGGCAGAGGCAGTGGCAGGG - Intergenic
1025177209 7:56808041-56808063 CTGGGGCAGAGGCAGTGGCAGGG - Intergenic
1025694583 7:63768345-63768367 CTGGGGCAGAGGCAGTGGCAGGG + Intergenic
1026325668 7:69307074-69307096 CAGTGGCAGAGGAAGAGGGAGGG + Intergenic
1026433376 7:70370322-70370344 CTGGGGCAGTGGAATGGGCAAGG - Intronic
1026468125 7:70671953-70671975 CCGTGGCAGTGAGAGTGGAAGGG + Intronic
1027150997 7:75733578-75733600 CTCTGGCAGTGACAGTGGCCAGG + Intronic
1027417599 7:77989947-77989969 CTGTTCTGGTGGAAGTGGCAGGG + Intergenic
1028037452 7:86003049-86003071 CAATGACAGTGGTAGTGGCAGGG + Intergenic
1028241261 7:88423859-88423881 CTGTGGAAGTGGGCATGGCAGGG + Intergenic
1028401654 7:90431513-90431535 CTGCTCCAGTGGAGGTGGCAGGG - Intronic
1029123715 7:98283951-98283973 CTAGGGAAGGGGAAGTGGCAGGG - Intronic
1030345754 7:108431279-108431301 CTGTGGCAGTGGAAGTGGCACGG - Intronic
1030972382 7:116076027-116076049 CTGTTCCAGTGGAGGTAGCAAGG - Intronic
1031124281 7:117756039-117756061 CTGAGGAAGGAGAAGTGGCAGGG - Intronic
1031138916 7:117919514-117919536 CTGCTCCAGTGGAGGTGGCAGGG - Intergenic
1031353406 7:120762794-120762816 ATCTGGCAGTGGTAGTGGGATGG + Intergenic
1031756439 7:125649261-125649283 GTGTGGCTTTGGAAGTGGAAGGG - Intergenic
1031796842 7:126185922-126185944 CTGCCCCAGTGGAAGTAGCAGGG + Intergenic
1031822514 7:126522235-126522257 ATGTGGCGGTGGAAGTGGAAAGG - Intronic
1031828012 7:126589733-126589755 CTGCTCCAGTGGAGGTGGCAGGG - Intronic
1032052108 7:128656048-128656070 CTGGGGCAGAGGCAGTGGCAGGG + Intergenic
1032429032 7:131846025-131846047 CAGAGGCAGTGGCGGTGGCAGGG + Intergenic
1032534178 7:132646796-132646818 CTGTGGAACTGGCAGTGGCTTGG - Intronic
1034705435 7:153139197-153139219 CTGCTCCAGTGGAGGTGGCAGGG + Intergenic
1035102730 7:156414850-156414872 CTGGGACAGTGGCAGTGGAAAGG - Intergenic
1035129036 7:156634642-156634664 TTGCTGCAGTGTAAGTGGCAGGG - Intergenic
1035299143 7:157885840-157885862 CTGAGGCAGGAGAAGTGACATGG - Intronic
1035888293 8:3316957-3316979 CTGTGTCAGTGGATGTGGGGAGG + Intronic
1036065898 8:5380958-5380980 CTGTGGCTGTGGGAGACGCAGGG + Intergenic
1036482520 8:9151222-9151244 GTGTGCCAGTGCAAGTCGCACGG + Intronic
1036854651 8:12231461-12231483 CTGTGGAGGTTGAAGTGGGAGGG + Intergenic
1037754580 8:21702749-21702771 CCATGGCACCGGAAGTGGCATGG - Intronic
1037786133 8:21904325-21904347 CTGTGACAGTGGGGGTGGCCAGG - Intergenic
1038367153 8:26948132-26948154 CTGTTCCGGTGGAGGTGGCAAGG + Intergenic
1039571884 8:38593310-38593332 CTGTAACGGTGGAGGTGGCAGGG - Intergenic
1039577339 8:38633936-38633958 TTGGGGCAGTGTAAGGGGCAGGG + Intergenic
1039829507 8:41201702-41201724 CAGTAGAAGTGGAAGTGACAGGG + Intergenic
1040415233 8:47189208-47189230 ATGTGGCAGTGGAAGGCGCAGGG + Intergenic
1040899264 8:52402105-52402127 TTGTGGCAGTGGTGGTGGCATGG + Intronic
1040932278 8:52747770-52747792 CTGTGGGCGTGGAGGTTGCAGGG - Intergenic
1041763601 8:61393792-61393814 CTGCTCCAGTGGAGGTGGCAGGG + Intronic
1041927026 8:63247985-63248007 CTGTTCCAGTGGAGGTAGCAGGG + Intergenic
1042129036 8:65568347-65568369 CTGTGGGAATGGAAGTGGGAAGG - Intergenic
1042467076 8:69140537-69140559 CTGTTCCGGTGGAGGTGGCAGGG + Intergenic
1042975587 8:74465437-74465459 GTGGGGCAGTGGAGGTGGAAGGG - Intronic
1043040840 8:75259934-75259956 CTGTTCCAGTGGAGGTGGCAGGG - Intergenic
1043048105 8:75352691-75352713 CTGCTCCAGTGGAGGTGGCAAGG - Intergenic
1043161660 8:76854252-76854274 CTGTGGCTGTGGCTGTGGCTGGG - Exonic
1043294419 8:78645915-78645937 CAGTGGCAGTGGCAGTGGCTCGG - Intergenic
1043477856 8:80622481-80622503 ATGTGTCAGTAGATGTGGCATGG + Intergenic
1043876370 8:85491343-85491365 CTGTTCCAGTGGAGGTAGCAGGG + Intergenic
1044072331 8:87778093-87778115 CTGTGGCAGTGGCTGTGGATAGG - Intergenic
1044072461 8:87778814-87778836 CAATGGCAATGGCAGTGGCAGGG - Intergenic
1044696596 8:94929151-94929173 CTGTGGCAGAGAAAGTGCCACGG + Exonic
1045412432 8:101932190-101932212 CTGTGGCAGGGGAGGGGGCCTGG - Intronic
1045638055 8:104215800-104215822 CTAGGGCAGTGGTAGTGGCAAGG - Intronic
1046592696 8:116225146-116225168 CTGGGGCAAAGGAAGTGGGAAGG + Intergenic
1046689098 8:117262806-117262828 CTGGGGCTGTGGAAGTGGACTGG + Intergenic
1047227272 8:122967535-122967557 CTGCTCCAGTGGAGGTGGCATGG + Intronic
1047284244 8:123472797-123472819 CTGTGGAAGAGAAAGAGGCAGGG + Intergenic
1047711150 8:127553728-127553750 CTGTGGCAGTGGGAGTGGCCAGG + Intergenic
1048371643 8:133783772-133783794 CTGCTCCAGTGGAGGTGGCAGGG + Intergenic
1049642255 8:143720992-143721014 CTGGGGCAGTGGAACCTGCAGGG - Exonic
1049684481 8:143933876-143933898 CTGGGGCAGGGGCAGGGGCAGGG - Intronic
1049687121 8:143943477-143943499 CTGTGGCAGCCGCCGTGGCAGGG - Intronic
1049786053 8:144451382-144451404 CTGTGGCTGTGGCCGTGGCCAGG - Intronic
1049869728 8:144965356-144965378 CTGCTCCAGTGGAGGTGGCAGGG + Intergenic
1049873550 8:145000429-145000451 CTGTGGCAGTGCACTTGGCCAGG + Intergenic
1050056384 9:1659920-1659942 CTGTGGCAGGGGCAGTGCCTGGG - Intergenic
1050327501 9:4511331-4511353 CTCACACAGTGGAAGTGGCAAGG + Intronic
1050756093 9:9005350-9005372 ATGTGTAAGTGGAAGTAGCATGG + Intronic
1050876970 9:10651229-10651251 CAGTGGCAGTGTAGGTGGGAAGG - Intergenic
1051110322 9:13627809-13627831 CAGTGGCAGTGGCAGTGCAATGG - Intergenic
1051338949 9:16093352-16093374 CTGTGGAGGTGGGAGAGGCAGGG + Intergenic
1051687639 9:19675240-19675262 CTGCTCCAGTGGAGGTGGCAGGG + Intronic
1052332341 9:27282519-27282541 CTGAGCCAGTGGAGGTGGCCTGG - Intergenic
1052386702 9:27831258-27831280 CTGTGGGAGTGGCAGGGGGAGGG - Intergenic
1052624856 9:30962117-30962139 CTGCTCCAGTGGAGGTGGCAGGG + Intergenic
1052630426 9:31030957-31030979 CAATGCCAGTGGAAGTGTCAGGG + Intergenic
1054460463 9:65459552-65459574 CTGTGGCACTGCAGGTCGCAAGG - Intergenic
1054703291 9:68435873-68435895 CTGTGGCAGTAAGAGTGACAAGG - Intronic
1055346929 9:75349754-75349776 CTGTTCCAGTGGAGGTGGCGAGG + Intergenic
1056535964 9:87528052-87528074 CAGTGTCAGTGCAAGTGGCTTGG - Intronic
1056927140 9:90844482-90844504 CTGTGGCTGTGAAAGAGGAAAGG - Intronic
1057311081 9:93943697-93943719 CTGAGGCAGGGGCAGGGGCAGGG - Intergenic
1057489196 9:95508589-95508611 ATGTGGCAATGGAAGGCGCAGGG - Exonic
1057802736 9:98199896-98199918 TAGTGGTGGTGGAAGTGGCAAGG + Intronic
1058487610 9:105458048-105458070 CTTGGCCAGTGGGAGTGGCAGGG + Intronic
1058781157 9:108336936-108336958 CTGTGACAAAGAAAGTGGCAAGG + Intergenic
1058784503 9:108374131-108374153 CTGCTCCAGTGGAGGTGGCAGGG + Intergenic
1059101295 9:111474416-111474438 CAGTGGAAGTGGATTTGGCAAGG - Intronic
1059336123 9:113569399-113569421 CTGTGGAATGGGAGGTGGCATGG + Intronic
1059449420 9:114361048-114361070 CTGAGGCTGGGGAGGTGGCAGGG - Intronic
1059463262 9:114448861-114448883 CTGTGGGTGAGGAAGTGACAAGG - Intronic
1059923954 9:119187387-119187409 TTGTGGCAGTGGTGGTGGCAAGG - Intronic
1060727830 9:126017485-126017507 CAGTGGCAGTGGAGGTGGAGAGG + Intergenic
1061382334 9:130265928-130265950 CAGTGGCAGTGGCAGTGGCCGGG + Intergenic
1062245784 9:135565393-135565415 CTCTGGCTGTGGAAGAGGCTGGG - Exonic
1062292960 9:135805609-135805631 CGGTGGCGGTGGAAGGGGAAGGG - Intergenic
1062754848 9:138281638-138281660 CTGGGGCAGAGGCAGTGGCAGGG + Intergenic
1203578756 Un_KI270745v1:25807-25829 CTGGGGCAGAGGCAGTGGCAGGG + Intergenic
1187219149 X:17307512-17307534 CTGTTCCAGTCGAGGTGGCAGGG + Intergenic
1188400715 X:29740594-29740616 GTGTGGCAGTGGAAATAGAAAGG - Intronic
1190093267 X:47458599-47458621 CTGTGGAAGTGCAAATGGCCAGG + Intronic
1190253835 X:48747811-48747833 CAGGGGCAGGGGGAGTGGCATGG - Intergenic
1190286670 X:48966122-48966144 CTGAGGCAGTGGAGTTGGCAAGG + Exonic
1190495265 X:51022487-51022509 CTATGGCATTGAAAGTGGCAAGG + Intergenic
1190510795 X:51172160-51172182 CTGTGGCATTGAAAGTTGCAAGG - Intergenic
1190817058 X:53938312-53938334 CTGTGGCTGTGGCTGTGGCTGGG - Exonic
1190895424 X:54613798-54613820 CTGTTCCTGTGGAGGTGGCAGGG + Intergenic
1190895428 X:54613804-54613826 CTGTGGAGGTGGCAGGGGCAGGG + Intergenic
1191177139 X:57516498-57516520 CGGTGGCAGTGGTGGGGGCAGGG + Intergenic
1191755073 X:64584045-64584067 CTGTGGCAGCTGTAGTGGCATGG - Intergenic
1192069016 X:67917801-67917823 CTGTTCCAGTGGAGGTGGCATGG + Intergenic
1192876060 X:75230705-75230727 CTGCTCCAGTGGAAGTGGCAGGG - Intergenic
1192881049 X:75284683-75284705 CTGTTCCAGTGGAGGTGGCAGGG + Intronic
1192968130 X:76202065-76202087 CTGTTCCAGTGGAGGTGGCAGGG + Intergenic
1193067574 X:77275739-77275761 CTGTGGCAGTGGTGGTGGTGGGG - Intergenic
1193791694 X:85822125-85822147 CTGCTACAGTGGAGGTGGCAGGG - Intergenic
1193934814 X:87604835-87604857 CTGTGACATTGGGAGGGGCAAGG - Intronic
1193937678 X:87642145-87642167 CTCTTCCAGTGGAGGTGGCAGGG - Intronic
1194051560 X:89075455-89075477 TTGTTGCAGTGTGAGTGGCAAGG + Intergenic
1194165403 X:90508414-90508436 CTGCTCCAGTGGAGGTGGCAGGG - Intergenic
1194547590 X:95257104-95257126 CTGCTCCAGTGGAAGTGGCAGGG + Intergenic
1194882517 X:99271737-99271759 CTGTTCCAGTGGAGGTGGCAGGG + Intergenic
1195033809 X:100952361-100952383 GGGTGGCAGTGGCAGTGGCATGG + Intergenic
1195231920 X:102859134-102859156 CTGCTCCAGTGGAGGTGGCAGGG + Intergenic
1195577395 X:106467387-106467409 CTGTGCCAATAGAAGTTGCAAGG + Intergenic
1195795511 X:108642491-108642513 CTCTTCCAGTGGAGGTGGCAGGG - Intronic
1195838198 X:109143450-109143472 CTGTTCCAGTGGAGGTAGCAGGG - Intergenic
1195985120 X:110621426-110621448 CTGCTCCAGTGGAGGTGGCAAGG + Intergenic
1196675693 X:118418569-118418591 CTGTACCAGTGGAAGTGGCAGGG + Intronic
1197055442 X:122113481-122113503 CTGCTCCAGTGGAGGTGGCAGGG + Intergenic
1197081696 X:122426138-122426160 CTGTTCCAGTGGAAGTGACAGGG + Intergenic
1197422683 X:126258123-126258145 CAGTGGCAGTGGCAGTGTGAAGG + Intergenic
1197669028 X:129255614-129255636 CTGTTCCAGTGGAGGTGGCAGGG + Intergenic
1197728914 X:129794106-129794128 CTGTGGCCGTGGCCATGGCAGGG - Exonic
1198018489 X:132635378-132635400 CTGGGGGTGTGGAAGTGGCATGG - Intronic
1198713789 X:139534463-139534485 CTGTGGCTGTGGAACTCACAAGG - Intronic
1200466731 Y:3528821-3528843 CTGTGGCTGTGGCAGCTGCAAGG + Intergenic
1200511671 Y:4086224-4086246 CTGCTCCAGTGGAGGTGGCAGGG - Intergenic
1202381375 Y:24278425-24278447 CTGGGGCAGAGGCAGTGGCAGGG + Intergenic
1202489410 Y:25391701-25391723 CTGGGGCAGAGGCAGTGGCAGGG - Intergenic