ID: 1030347864

View in Genome Browser
Species Human (GRCh38)
Location 7:108454979-108455001
Sequence CACCGAGGGAGGGCGCCGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 157}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030347864_1030347883 25 Left 1030347864 7:108454979-108455001 CCGCTCGGCGCCCTCCCTCGGTG 0: 1
1: 0
2: 0
3: 6
4: 157
Right 1030347883 7:108455027-108455049 GCGTACGGGGGACGAAGATGTGG 0: 1
1: 0
2: 0
3: 4
4: 32
1030347864_1030347877 12 Left 1030347864 7:108454979-108455001 CCGCTCGGCGCCCTCCCTCGGTG 0: 1
1: 0
2: 0
3: 6
4: 157
Right 1030347877 7:108455014-108455036 GGGCCACCCGCCAGCGTACGGGG 0: 1
1: 0
2: 0
3: 3
4: 42
1030347864_1030347868 -10 Left 1030347864 7:108454979-108455001 CCGCTCGGCGCCCTCCCTCGGTG 0: 1
1: 0
2: 0
3: 6
4: 157
Right 1030347868 7:108454992-108455014 TCCCTCGGTGCCCGCGGCGCAGG No data
1030347864_1030347875 10 Left 1030347864 7:108454979-108455001 CCGCTCGGCGCCCTCCCTCGGTG 0: 1
1: 0
2: 0
3: 6
4: 157
Right 1030347875 7:108455012-108455034 AGGGGCCACCCGCCAGCGTACGG 0: 1
1: 0
2: 0
3: 2
4: 43
1030347864_1030347870 -9 Left 1030347864 7:108454979-108455001 CCGCTCGGCGCCCTCCCTCGGTG 0: 1
1: 0
2: 0
3: 6
4: 157
Right 1030347870 7:108454993-108455015 CCCTCGGTGCCCGCGGCGCAGGG 0: 1
1: 0
2: 0
3: 6
4: 103
1030347864_1030347872 -8 Left 1030347864 7:108454979-108455001 CCGCTCGGCGCCCTCCCTCGGTG 0: 1
1: 0
2: 0
3: 6
4: 157
Right 1030347872 7:108454994-108455016 CCTCGGTGCCCGCGGCGCAGGGG No data
1030347864_1030347878 13 Left 1030347864 7:108454979-108455001 CCGCTCGGCGCCCTCCCTCGGTG 0: 1
1: 0
2: 0
3: 6
4: 157
Right 1030347878 7:108455015-108455037 GGCCACCCGCCAGCGTACGGGGG 0: 1
1: 0
2: 0
3: 2
4: 29
1030347864_1030347876 11 Left 1030347864 7:108454979-108455001 CCGCTCGGCGCCCTCCCTCGGTG 0: 1
1: 0
2: 0
3: 6
4: 157
Right 1030347876 7:108455013-108455035 GGGGCCACCCGCCAGCGTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030347864 Original CRISPR CACCGAGGGAGGGCGCCGAG CGG (reversed) Intronic
904081029 1:27872683-27872705 CACCAAGGGAGTGCTCGGAGGGG - Intronic
905297445 1:36963106-36963128 GACCGAGGCAGGGAGCCCAGGGG + Intronic
907525990 1:55054450-55054472 CACGGAGGGAGGGAGTGGAGTGG - Intronic
909547995 1:76868429-76868451 CACCGGAGGAGCGCGCCCAGCGG - Intronic
913130999 1:115838516-115838538 CGACGCGGGAGGGCGCCGATAGG + Exonic
914354870 1:146875879-146875901 CACAGAGGGATGGTGCCAAGAGG - Intergenic
922100066 1:222472382-222472404 CACCTGGAGAGGCCGCCGAGAGG + Intergenic
922100271 1:222473210-222473232 CACCTGGAGAGGCCGCCGAGAGG + Intergenic
922100471 1:222474010-222474032 CATCCAGAGAGGCCGCCGAGAGG + Intergenic
922207054 1:223456942-223456964 CACTGAGGGAGAGCAGCGAGTGG + Intergenic
922734974 1:227973866-227973888 CACCTGGAGAGGCCGCCGAGAGG - Intergenic
922933876 1:229409496-229409518 CACCCAGGGACGGCTCAGAGAGG - Intergenic
924343264 1:243054047-243054069 CACCTGGAGAGGCCGCCGAGAGG + Intergenic
1062961173 10:1574624-1574646 CACAGAGGGAGGACCCCGTGAGG - Intronic
1066733228 10:38451545-38451567 CACCTGGAGAGGCCGCCGAGAGG - Intergenic
1067362459 10:45594887-45594909 CTCCGCGGGAGGACACCGAGTGG + Intronic
1067791109 10:49288429-49288451 CACCGAGGAACAGCGACGAGTGG + Intergenic
1072688120 10:97550826-97550848 CCCCAAGGGAGGGCACCGAAAGG - Intronic
1073063507 10:100745644-100745666 GAGGGAGGGAGGGAGCCGAGCGG - Intronic
1078057533 11:8019664-8019686 CCCCGAGAAAGGGCGCGGAGGGG + Intronic
1083272895 11:61580926-61580948 GTCCGAGGGCGGGGGCCGAGCGG + Intronic
1084952613 11:72674975-72674997 CACCGGGTGAGGGAGCCCAGAGG - Intergenic
1088653288 11:111976980-111977002 CACCAAGGGAGGGCTCAGAGTGG + Intronic
1092286626 12:7132414-7132436 GACAGAGGGAGGGGGCAGAGAGG - Intronic
1093997153 12:25654873-25654895 CACTGAGGGAAGGCCCAGAGAGG - Intergenic
1103952034 12:124556529-124556551 AACCGAGGGAGGGAGGGGAGAGG + Intronic
1104134365 12:125923367-125923389 CACAGAAGGAGGGAGCAGAGAGG + Intergenic
1104879326 12:132059241-132059263 CACCGAGGTAGGGCCCCAGGTGG + Intronic
1104987919 12:132607499-132607521 CACGGGGTGAGGGAGCCGAGGGG - Intronic
1106602440 13:31199785-31199807 CCTCGAAGGAGGGCGCCGTGAGG + Intergenic
1113657085 13:112073621-112073643 CATCGGGGACGGGCGCCGAGGGG + Intergenic
1118843333 14:69528389-69528411 CACCCCGGGAGAGTGCCGAGGGG - Exonic
1121020132 14:90575005-90575027 CACACAGGGAGAGCGGCGAGGGG - Intronic
1121144774 14:91574246-91574268 CCCCGAGGCAGGGCGCGGGGCGG - Intergenic
1122794720 14:104200453-104200475 CACAGAGGGAAGGCCCCGTGAGG - Intergenic
1124477322 15:30045813-30045835 CACCGTGGGAGGCAGCCCAGAGG - Intergenic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1131798346 15:96043773-96043795 CACCGAGGGAGGGAGGCATGGGG + Intergenic
1132873884 16:2127426-2127448 CACCGAGGCTGGGTGCTGAGGGG + Intronic
1133760992 16:8798019-8798041 CACCCAGGGTAGGCGCCAAGGGG + Intronic
1134552971 16:15146600-15146622 CACCGAGGCTGGGTGCTGAGGGG + Intergenic
1138583970 16:57958643-57958665 CACCGAGGGAGGGTGGAGAGGGG - Intronic
1139979150 16:70839650-70839672 CACACAGGGATGGTGCCGAGAGG + Intronic
1141772264 16:86096493-86096515 CACCCAGGGAGGTGGCGGAGTGG - Intergenic
1142450682 16:90171531-90171553 CACCTGGAGAGGCCGCCGAGAGG - Intergenic
1142581108 17:943382-943404 CACAGAGGGAAGGCCCAGAGAGG + Intronic
1142685614 17:1575458-1575480 CTCCGAGGCAGGGCCCCGGGAGG + Exonic
1142720058 17:1770031-1770053 CACCCAGCGAGAGGGCCGAGAGG - Exonic
1144727582 17:17509602-17509624 CACTGAGGGAGGCCCCAGAGCGG + Intronic
1147938196 17:44025691-44025713 AACTGAGGGAGGGCCCCAAGGGG - Intergenic
1151572844 17:74935885-74935907 CACCGACTGCGGGCGCTGAGCGG - Exonic
1152069469 17:78127821-78127843 CACTGAGGGAGGGCGCCGTCCGG - Intronic
1152225474 17:79090688-79090710 CACCGAGGGAGCACGCCGGCAGG - Intronic
1152834337 17:82519772-82519794 AGCTGAGGGAGGGGGCCGAGCGG - Exonic
1152896732 17:82915680-82915702 CACCGAGGGCAGGGGCCGGGAGG + Intronic
1154128091 18:11712044-11712066 CACGGAGGGAGGGAGAAGAGTGG - Intronic
1157934110 18:51855091-51855113 CATGGAGGGAGGGAGCTGAGTGG + Intergenic
1160357191 18:78238677-78238699 CACCGTGGGCGGGAGGCGAGAGG + Intergenic
1160779276 19:870759-870781 CATGGAGGGAGGGAGCCGTGTGG + Intronic
1160779294 19:870805-870827 CATGGAGGGAGGGAGCCGTGTGG + Intronic
1160779312 19:870851-870873 CATGGAGGGAGGGAGCCGTGTGG + Intronic
1160791532 19:925825-925847 GACCGCGGGAGGGGGGCGAGGGG + Intronic
1160908942 19:1465992-1466014 CCCGGAGGGCGGGCGGCGAGAGG + Exonic
1161232608 19:3182169-3182191 GACCCAGGGAGGGCGCCTTGTGG - Intergenic
1161649351 19:5474781-5474803 CACGGAGGGAGGGAGGGGAGGGG + Intergenic
1161849571 19:6731521-6731543 CACTGAGGGTGGGCACAGAGAGG + Exonic
1163375544 19:16928035-16928057 GACCCAGGGATGGCGCCGTGTGG + Exonic
1165426722 19:35750042-35750064 CACTGAGGCAGGGAGCCAAGGGG + Intronic
1167503754 19:49861005-49861027 CACACAGGGAGGGCGCTGTGTGG - Intergenic
1167812573 19:51847521-51847543 CACCGATGGAGGGGGCCGTCAGG - Intergenic
925022204 2:580209-580231 CTCCGTGTGAGGGCGCTGAGTGG + Intergenic
925041255 2:733169-733191 CATGGAGGGAGGGCGCCAGGCGG + Intergenic
927134967 2:20090374-20090396 AACAGAGGGAGGAAGCCGAGGGG - Intergenic
932812227 2:74834858-74834880 CAGGGAGGGAGGGCGCCCGGCGG - Intronic
934910761 2:98252128-98252150 CACGAAGGGTGGGCGCTGAGAGG - Intronic
940009464 2:149038757-149038779 AGCCGGGTGAGGGCGCCGAGAGG + Exonic
1173706200 20:45111990-45112012 CACCCAGGCAGGGGGCTGAGGGG - Intronic
1174864629 20:54123799-54123821 ACCAGAGGGAGGGCGCTGAGAGG + Intergenic
1175376950 20:58534490-58534512 CAGGGAGGGAGGGTGCAGAGAGG - Intergenic
1176053759 20:63134303-63134325 CACGGAAGGAAGGAGCCGAGGGG - Intergenic
1176357846 21:5967206-5967228 CACGGAGGGAGGGCCCCACGAGG + Intergenic
1178992504 21:37367312-37367334 CGGCGAGGCCGGGCGCCGAGCGG - Intronic
1179407570 21:41138056-41138078 CACCGTTGGAGGGCACTGAGTGG - Intergenic
1179570912 21:42278539-42278561 CACCAAGGGATGGCCCCGTGAGG + Intronic
1179658014 21:42857398-42857420 CACCCAGGGTGGGGCCCGAGGGG - Intronic
1179765672 21:43571345-43571367 CACGGAGGGAGGGCCCCACGAGG - Intronic
1179965514 21:44802366-44802388 CTCCGAGGGAGAGAGCCGCGGGG + Intergenic
1180649989 22:17369607-17369629 AGCCGAGGGCGGGCGCCGGGCGG - Exonic
1181010303 22:20036458-20036480 CACCGAGCTGGGGTGCCGAGGGG - Intronic
1181618579 22:24071877-24071899 CACCCAGGGAGGGCAAGGAGTGG - Intronic
1182665077 22:31952034-31952056 CACTGAGGGAAGGTGCCGTGTGG + Intronic
1184820971 22:46909061-46909083 CACCCAGGGAGGATGCCGAGGGG - Intronic
1185359206 22:50395284-50395306 CACAGAGGGAGGGGGCAGTGTGG + Intronic
950486253 3:13275675-13275697 CACGGAGGAAGGGGGCCAAGTGG - Intergenic
953200221 3:40771820-40771842 ACCTGAGGGAGGGGGCCGAGAGG - Intergenic
956779747 3:72594545-72594567 CACAGAGAGAGGTCGCAGAGAGG - Intergenic
968513066 4:1003724-1003746 CGGCGAGGGAGGGAGCCGATGGG - Intronic
969114072 4:4860389-4860411 CGCAGAGGGAGGGGGCCGGGTGG + Intronic
973820431 4:54657879-54657901 CGCAGAGGGAGGGCGCTGGGAGG + Intergenic
979328806 4:119406133-119406155 CACCTGGAGAGGCCGCCGAGAGG + Intergenic
979329010 4:119406933-119406955 CACCCGGAGAGGCCGCCGAGAGG + Intergenic
985575940 5:673550-673572 CACCGTGAGTGGGCGCCGTGTGG - Intronic
985610248 5:883900-883922 CACCGAGAGAGGGTGCCACGTGG - Intronic
988710751 5:33772100-33772122 CACCTTGGGAGGCCGCAGAGAGG - Intronic
991361776 5:65828198-65828220 CACCGGGGGAGGGGGACGGGAGG + Exonic
998152335 5:139764595-139764617 CGCCGGGGGAGGGCGGCGCGCGG - Intergenic
998284333 5:140843502-140843524 CACTGAGGGCGGGTGCCGGGCGG + Exonic
999203613 5:149833224-149833246 CACCGAGGACGGGCGACCAGGGG - Exonic
1002792913 6:448795-448817 CACAGAGGGAGGCCCCCGCGAGG + Intergenic
1004427041 6:15513641-15513663 GACCGAGGGAGGGCCACGCGTGG - Intronic
1012620610 6:101339687-101339709 CAGGGAGGCAGGGCACCGAGAGG - Intergenic
1013619161 6:111872502-111872524 CGCCGAGGGAGGAGGCCGAGAGG + Intronic
1016038087 6:139403736-139403758 CACGGAGGTAGGGCCCCGAATGG - Intergenic
1023400785 7:39792161-39792183 CACCCGGAGAGGCCGCCGAGAGG - Intergenic
1023401293 7:39794117-39794139 CACCTGGAGAGGCCGCCGAGAGG - Intergenic
1024648320 7:51386564-51386586 CACCTGGAGAGGCCGCCGAGAGG + Intergenic
1024648851 7:51388637-51388659 CACCTGGAGAGGCCGCCGAGAGG + Intergenic
1024649083 7:51389522-51389544 CACCCAGAGAGGCTGCCGAGAGG + Intergenic
1025052171 7:55741033-55741055 CACCGGGAGAGGCCGCCGAGAGG + Intergenic
1025129129 7:56366716-56366738 CACCTGGAGAGGCCGCCGAGAGG + Intergenic
1025177516 7:56809605-56809627 CACCTGGAGAGGCCGCCGAGAGG + Intergenic
1025177785 7:56810717-56810739 CACCTGGAGAGGCCGCCGAGAGG + Intergenic
1025177941 7:56811352-56811374 CACCTGGAGAGGCCGCCGAGAGG + Intergenic
1025178373 7:56813106-56813128 CACCTGGAGAGGCCGCCGAGAGG + Intergenic
1025178803 7:56814848-56814870 CACCTGGAGAGGCCGCCGAGAGG + Intergenic
1025179241 7:56816638-56816660 CACCTGGAGAGGCCGCCGAGAGG + Intergenic
1025179699 7:56818524-56818546 CACCTGGAGAGGCCGCCGAGAGG + Intergenic
1025180147 7:56820362-56820384 CACCTGGAGAGGCCGCCGAGAGG + Intergenic
1025181063 7:56824191-56824213 CACCTGGAGAGGCCGCCGAGAGG + Intronic
1025181492 7:56825933-56825955 CACCTGGAGAGGCCGCCGAGAGG + Intronic
1025690421 7:63751047-63751069 CACCTGGAGAGGCCGCCGAGAGG - Intergenic
1025690869 7:63752870-63752892 CACCTGGAGAGGCCGCCGAGAGG - Intergenic
1025691309 7:63754645-63754667 CACCTGGAGAGGCCGCCGAGAGG - Intergenic
1025691748 7:63756469-63756491 CACCTGGAGAGGCCGCCGAGAGG - Intergenic
1025692195 7:63758292-63758314 CACCTGGAGAGGCCGCCGAGAGG - Intergenic
1025693057 7:63761794-63761816 CACCTGGAGAGGCCGCCGAGAGG - Intergenic
1025693503 7:63763617-63763639 CACCTGGAGAGGCCGCCGAGAGG - Intergenic
1025694248 7:63766648-63766670 CACCTGGAGAGGCCGCCGAGAGG - Intergenic
1029745149 7:102512409-102512431 GACAGAGGGAGGGGGCTGAGAGG + Intronic
1029763141 7:102611570-102611592 GACAGAGGGAGGGGGCTGAGAGG + Intronic
1030347864 7:108454979-108455001 CACCGAGGGAGGGCGCCGAGCGG - Intronic
1032051793 7:128654482-128654504 CACCTGGAGAGGCCGCCGAGAGG - Intergenic
1032096433 7:128940574-128940596 GGCTGAGGGAGGGAGCCGAGTGG - Intronic
1035424728 7:158762063-158762085 CACCGAGTGAGGGCGTCCATCGG - Intronic
1037473887 8:19237597-19237619 AACCGCGGGAGGGCGCTGTGCGG + Intergenic
1039843377 8:41309123-41309145 CAGCGAGGGGGGCCGCCGCGGGG - Exonic
1048981058 8:139703591-139703613 CACCGAGAGGGGGCGAGGAGGGG - Intergenic
1049803967 8:144530626-144530648 GAGCGAGGGTGGGCGCGGAGGGG + Intronic
1052781295 9:32783708-32783730 AACCAAGGGAGCGAGCCGAGGGG + Exonic
1060152832 9:121299743-121299765 CCCCCAGGGAGGGCGCGGGGCGG - Intronic
1060617356 9:125029996-125030018 CACCGAGGGAGAGGGAAGAGAGG - Intronic
1060917347 9:127398908-127398930 CACCCAGGGAGGGGCCTGAGTGG - Intronic
1061090086 9:128421324-128421346 CACCCAGGGAAGGCCCCAAGAGG - Intronic
1061727516 9:132589721-132589743 CCGCGAGAGAGGACGCCGAGGGG - Exonic
1061975757 9:134067497-134067519 AACCCAGGGAGGACGCGGAGGGG - Intronic
1062558909 9:137130332-137130354 CGCCGAGCGAGGGGGCCAAGCGG + Intergenic
1185750825 X:2608903-2608925 CAGCAAGGGCGGGCGCGGAGAGG + Intergenic
1188859918 X:35244294-35244316 CACCGTTGGAGGGAGCCAAGGGG - Intergenic
1189726623 X:43973647-43973669 CTCCGTGGAAGGGAGCCGAGCGG - Intergenic
1200110539 X:153738530-153738552 CCCAGAGGGAGAGCGCCGTGTGG - Intronic
1200183976 X:154169818-154169840 CCCAGAGGGAGAGCGCCGTGTGG - Intergenic
1200189630 X:154206946-154206968 CCCAGAGGGAGAGCGCCGTGTGG - Intergenic
1200195383 X:154244755-154244777 CCCAGAGGGAGAGCGCCGTGTGG - Intergenic
1200201035 X:154281876-154281898 CCCAGAGGGAGAGCGCCGTGTGG - Intronic