ID: 1030352085

View in Genome Browser
Species Human (GRCh38)
Location 7:108500955-108500977
Sequence CCTCAGATGGTGGCAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 9, 3: 33, 4: 372}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030352085 Original CRISPR CCTCAGATGGTGGCAGTGGA AGG (reversed) Intronic
900811417 1:4804243-4804265 TCTCCTATGGTTGCAGTGGATGG + Intergenic
900874175 1:5329802-5329824 CCTCACATGGTGGAAGGGGAAGG + Intergenic
900967442 1:5968689-5968711 CGTCTTATGGTGGCAGTAGAAGG - Intronic
901813058 1:11778702-11778724 CCTGAGATGGTGGCACTTGAGGG + Exonic
901839481 1:11944883-11944905 CCTGAGGTGGTGGGAGGGGAGGG + Intronic
901961318 1:12828583-12828605 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901967910 1:12883188-12883210 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901975714 1:12942318-12942340 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901983308 1:13053453-13053475 CCTCAGAGGGAGGCGGCGGAAGG + Intronic
901985702 1:13073878-13073900 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
901996107 1:13152889-13152911 CCTCAGAGGGAGGCGGCGGAAGG + Intergenic
901998780 1:13175465-13175487 CCTCAGAGGGAGGCGGCGGAAGG - Intergenic
902005129 1:13225906-13225928 CCCCAGAGGGAGGCAGGGGAAGG + Intergenic
902009460 1:13259447-13259469 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902017266 1:13318592-13318614 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902024354 1:13371700-13371722 CCCCAGAGGGAGGCAGGGGAAGG + Intergenic
902893878 1:19465312-19465334 CCTCACATGGTGGAAGGGGCTGG - Intronic
903003751 1:20284722-20284744 CCAGAGAAGGTGGCAGTGGCAGG - Intergenic
903064956 1:20694336-20694358 CCTCAGATCCTGCCAGAGGAGGG + Intronic
903766007 1:25734678-25734700 CCTCACATAGAGGCAGTGCAGGG + Intronic
903786123 1:25862512-25862534 CCCCAGTGAGTGGCAGTGGAAGG + Exonic
903827307 1:26155524-26155546 TCTCAGTTGGTGGCAGAGGCAGG - Intergenic
904449021 1:30599144-30599166 CTGCAGATGGGGGCAGTGGGAGG - Intergenic
905489935 1:38335399-38335421 CATGTGATGGTGGCAGTGGAAGG - Intergenic
905825383 1:41022566-41022588 CCTCAACTGGTGGCAGTGCGAGG + Exonic
905945395 1:41897452-41897474 CCTCAGATGGTGGAGGGGTAGGG - Intronic
906530334 1:46520193-46520215 CCTCAGAGGGTTGCAGAGGGAGG + Intergenic
906869883 1:49466547-49466569 CCTGGGATTGTGGCAGGGGATGG - Intronic
907482531 1:54754811-54754833 CCACAGGTGGGGGCCGTGGAAGG - Intergenic
907768609 1:57437128-57437150 CTTCAGATGGTGAAAGTGAATGG + Intronic
908113870 1:60922680-60922702 CCTCAGATGTTGGCAATGCTGGG + Intronic
908267358 1:62392579-62392601 CCTCAAATGGTGGAAGGGTAAGG - Intergenic
910216836 1:84851903-84851925 CCTCAGCTGGTGGTGGGGGAAGG + Intronic
911082654 1:93949199-93949221 TCTTACATGGTGGCAGAGGAGGG + Intergenic
911300190 1:96163389-96163411 CCTCAGAGGGTTGCAGAAGAGGG + Intergenic
911439311 1:97905642-97905664 GGCCAGATGGTTGCAGTGGAGGG - Intronic
913050289 1:115111658-115111680 CCTCACATGGTAGAAGGGGAAGG - Intergenic
914944668 1:152053402-152053424 CCTCAGATGGAGGCATGAGAGGG + Intergenic
915322427 1:155063109-155063131 CCTCAGGTGGCGGCGGCGGAGGG - Intergenic
915500262 1:156311116-156311138 CCTCAGCTGGTGCCAGGGGGTGG - Exonic
917455771 1:175184357-175184379 CCTCACACGGTGCCACTGGAAGG + Intronic
917607166 1:176643954-176643976 AGCCAGATGGTGGGAGTGGAGGG + Intronic
918121434 1:181544586-181544608 CTACAAATGGTGGCAGTGGTGGG + Intronic
918356589 1:183710660-183710682 CTTCACATGGTGGCAGGAGAGGG + Intronic
918578766 1:186099562-186099584 CCACAGATGGAGGAAGTTGAGGG - Intronic
920189790 1:204186285-204186307 CTTCAGATGCTGACATTGGAGGG - Intergenic
920574824 1:207051608-207051630 ATTCAGGTGGTGGCAGTGTAAGG + Intronic
921726876 1:218533934-218533956 CCCAAGATGGTGGCAGTGGAAGG + Intergenic
922064911 1:222127147-222127169 CCTCATAAGGTGACATTGGAGGG - Intergenic
922422973 1:225471766-225471788 CCTCAGGCGGCGGCAGTGCAGGG - Intergenic
922827051 1:228529146-228529168 CCTTGGATGGTGGCATTGCAGGG + Intergenic
923679803 1:236110399-236110421 TTTCAGATGGTCACAGTGGATGG - Intergenic
923766849 1:236900458-236900480 CCACAGAAGGAGGAAGTGGAAGG + Exonic
923773969 1:236961737-236961759 CATCACATGGTGACAGAGGAAGG - Intergenic
923961104 1:239084789-239084811 CCTCAGATGGAGGCAGGGCTAGG + Intergenic
1062930325 10:1348534-1348556 CCTCAGATGGAGGCAGCCGAGGG - Intronic
1062957662 10:1551022-1551044 CCTCAGAAGGTGACAGTGTTTGG + Intronic
1063677048 10:8150074-8150096 CCTCAGAAGGTGGCCAGGGAGGG - Intergenic
1065388406 10:25157007-25157029 CCTCACATGGTGGCAAGGCATGG - Intergenic
1065666710 10:28071026-28071048 CCTCACCTGGTGACACTGGAAGG + Intronic
1066761184 10:38755101-38755123 CCTAAGCAGGTGGCAGAGGAAGG + Intergenic
1066960408 10:42217321-42217343 CCTAAGCAGGTGGCAGAGGAAGG - Intergenic
1067042457 10:42962267-42962289 CCTCAGAGGGTGGGAGGGAAGGG + Intergenic
1067430667 10:46241354-46241376 ACCCTGATGGTGGCAGTGGCAGG - Intergenic
1068824483 10:61419163-61419185 CCTCAGGTGGTGGCAGTGGTGGG + Intronic
1068959216 10:62849873-62849895 CCACAGATGGGGGCTGGGGATGG - Intronic
1069025621 10:63537738-63537760 CCACAGATGGAGGCAGGGAAGGG + Intronic
1069753837 10:70761434-70761456 CCTCAGCTGGTGGAACTGCATGG - Exonic
1069780607 10:70953108-70953130 GCTCAGAGGTTGGGAGTGGAAGG - Intergenic
1069926599 10:71854977-71854999 TCCCAGAGGGTGGTAGTGGAAGG - Intergenic
1070735689 10:78862147-78862169 CCCCACATGGTGGCTGTGGATGG - Intergenic
1071599219 10:86948845-86948867 CCTCAGATGGCTGAGGTGGAAGG + Intronic
1072012236 10:91312710-91312732 TCTTAGATGGTGGCAGAGGCAGG - Intergenic
1072451720 10:95544250-95544272 CCTCAGAGGGTGGTAGTCGGGGG - Intronic
1072842514 10:98790338-98790360 ACTCAGAAGGTGGAACTGGAGGG + Intronic
1073424440 10:103447786-103447808 CCTGAGATGATGGCAGGGGAAGG - Intronic
1073893179 10:108123738-108123760 ACACAAATGGTGGCTGTGGAAGG + Intergenic
1074109827 10:110414918-110414940 CGGCAGAGGGTGGCAGTGGGTGG + Intergenic
1074143755 10:110698808-110698830 CTTCAGATGCTGGCAGAGGATGG + Intronic
1074586737 10:114775096-114775118 CTTCACATGGTGGCAGGAGAGGG + Intergenic
1075069510 10:119311449-119311471 CCTGAGATGGGGGCAGTGGGTGG + Intronic
1075362740 10:121853887-121853909 CCTCACATGATGGTAGGGGAAGG + Intronic
1075728011 10:124620513-124620535 CCCCAGCTGGGGGCAGTGGCAGG - Exonic
1075778915 10:125004707-125004729 CCTCAGAGGGAGGGAGGGGATGG - Intronic
1076992840 11:284637-284659 CCTCAGGTGGAGGCAGGGGTGGG + Exonic
1077358439 11:2129292-2129314 CTTCAGGTGATGGCAGAGGAGGG + Intronic
1077899893 11:6479733-6479755 ACTCAGGTGGTGGCAGGGAAAGG + Intronic
1078195818 11:9135852-9135874 CCACACATGGTGGAAGAGGAAGG - Intronic
1078992530 11:16664466-16664488 TCTCAGCTGGTGCCTGTGGAGGG + Intronic
1082066383 11:47904100-47904122 CTTCACATGGTGGAGGTGGAGGG - Intergenic
1083617198 11:64032161-64032183 TCTCAGCTGGGGGCAGGGGAAGG - Intronic
1084279400 11:68077459-68077481 CCACAGCTGGTGACAGTGGAGGG + Intronic
1084330533 11:68427304-68427326 CCTCAGATGGTTACCATGGAGGG - Intronic
1084530843 11:69726963-69726985 CCTCTGATGGTGGATGTGGCCGG - Intergenic
1084622621 11:70283539-70283561 CTTCAGCTGGTTGCAGTGGAAGG + Intronic
1084724392 11:70931454-70931476 CCTCAGAAGGTGGCAGCGCTGGG + Intronic
1084769063 11:71330998-71331020 CCTCAGATGGAGAGAATGGAGGG + Intergenic
1084960616 11:72714254-72714276 CCTCAGACTGTGGCTGGGGAGGG + Exonic
1089126441 11:116179731-116179753 CAGCAGATGGTGTCAGTGAAGGG + Intergenic
1089653121 11:119927871-119927893 TCTCAGATGGTGGTACTGGTGGG + Intergenic
1089735524 11:120547971-120547993 ACTCAGAGGGTGGCTGTGGGAGG + Intronic
1090022294 11:123138612-123138634 CACCAAATGGTGGCAGGGGAGGG - Intronic
1091369508 11:135046875-135046897 CCTGAGACGGTGGGGGTGGAGGG - Intergenic
1091369523 11:135046926-135046948 CCTGAGACGGTGGGGGTGGAGGG - Intergenic
1091369538 11:135046977-135046999 CCTGAGACGGTGGGGGTGGAGGG - Intergenic
1091369553 11:135047028-135047050 CCTGAGACGGTGGGGGTGGAGGG - Intergenic
1091369568 11:135047079-135047101 CCTGAGACGGTGGGGGTGGAGGG - Intergenic
1091768418 12:3136824-3136846 CCTCAGCTGGAGGCAGGGGTGGG + Intronic
1092780735 12:11984319-11984341 TCTCAGATGCTGGCATTTGAGGG - Intergenic
1093189101 12:16054814-16054836 TGTCAGATGGTGGAGGTGGAGGG + Intergenic
1093785570 12:23188266-23188288 AGTCAGATGGTAGCAGGGGATGG - Intergenic
1095393979 12:41742041-41742063 CCACAGATGGTGGGAGGGGATGG + Intergenic
1096749654 12:53750898-53750920 CGGCAGATGGAGCCAGTGGAGGG - Intergenic
1097177772 12:57153186-57153208 TCTCTGATGGTGGTAGTTGAAGG + Intronic
1097458805 12:59834378-59834400 CCCCAGATGGTGGGGGTGGGGGG - Intergenic
1098761737 12:74433933-74433955 CTTCACATGGTGGCAGGAGAGGG - Intergenic
1099705018 12:86141053-86141075 TCTCTCATGGTGCCAGTGGAAGG - Intronic
1100380717 12:94059235-94059257 CCACTCATGGTGGAAGTGGAAGG - Intergenic
1102222029 12:111201226-111201248 CCTCCGCTGGTAGCAGGGGATGG + Intronic
1102414322 12:112747305-112747327 CCTCACATGGTGGAAGGGCAAGG - Intronic
1103624196 12:122206098-122206120 CCTCAGATGATGGCAGAGGAGGG + Intronic
1104388199 12:128369018-128369040 CCTGAGAAGGTGTGAGTGGATGG + Intronic
1104678192 12:130729837-130729859 CCTGGGAAGGTGGCCGTGGAGGG + Intergenic
1104701538 12:130908209-130908231 CCTCAGGTGGTGGCAGAGTGAGG + Intergenic
1104966651 12:132511400-132511422 CCACAGGTGGGGGCCGTGGAAGG - Intronic
1105332554 13:19431799-19431821 CCTGAGATGGTGCCAGTGCTGGG - Intronic
1105465543 13:20636298-20636320 TCTCAGATGGTGGCAGGTTAGGG - Intronic
1105879131 13:24587978-24588000 CCTGAGATGGTGCCAGTGCTGGG + Intergenic
1105920706 13:24961074-24961096 CCTGAGATGGTGCCAGTGCTGGG - Intergenic
1106078633 13:26482356-26482378 CCTCAGCTGGAGGCAGTAGCTGG - Intergenic
1107855906 13:44615270-44615292 CATCAGATGGTGGAAGTGTGAGG + Intergenic
1107879094 13:44817482-44817504 CCCCAGGAGGTGGCATTGGATGG - Intergenic
1110062555 13:71061555-71061577 CTTCACATGGTGGCAGGAGAGGG + Intergenic
1111990172 13:95108575-95108597 CCTCACATGGTGGAAGGTGAAGG - Intronic
1112562335 13:100525792-100525814 CCTCAGATGCCTGCAGAGGAAGG + Intronic
1112836068 13:103515694-103515716 CCACAGGTGGTGGGAGTGGGGGG - Intergenic
1117461686 14:55951654-55951676 CATCAGATGGTGGCTGGGGCTGG - Intergenic
1118943051 14:70356194-70356216 CCACAGATGGTGGCGGGGGTGGG + Intronic
1119199998 14:72745082-72745104 CCTCAGGGGGTGGGTGTGGAGGG + Intronic
1119933665 14:78570958-78570980 TCTCTGATGGTGGCAGGGGTGGG + Intronic
1121303451 14:92890089-92890111 CCAGAGCTGGAGGCAGTGGAGGG - Intergenic
1121674250 14:95739594-95739616 CCTCAGATGATGAAAGTGGAAGG + Intergenic
1122495847 14:102154371-102154393 CCTCACATGGTGGAGGGGGAAGG + Intronic
1122981560 14:105194448-105194470 CTTCACCTGGTGGCAGAGGAGGG - Intergenic
1124395950 15:29301827-29301849 CCTCACATGGTGGAAGGGGCTGG - Intronic
1124688651 15:31803732-31803754 TCTCAGATGGTCACAGTGGAAGG - Intronic
1125366306 15:38920379-38920401 ACTCAGAGGGTGGCAGGGCAGGG + Intergenic
1126718699 15:51552374-51552396 ACACAGGTAGTGGCAGTGGAGGG + Intronic
1128894514 15:71360075-71360097 ACTCAGATGGTGGCTGAGGCTGG + Intronic
1129452839 15:75660245-75660267 CCACAGATGGGGGCTGGGGATGG + Exonic
1129703358 15:77780773-77780795 CCTCACATGGTGGGGGTGGGGGG - Intronic
1130189640 15:81721410-81721432 CCTCACAAGGTGGCAGGAGAAGG - Intergenic
1130562742 15:84971524-84971546 CCTCTCATGGTGGAAGGGGAAGG - Intergenic
1131483628 15:92802586-92802608 CCTAAGAGGGAGGCAGAGGAAGG - Intronic
1133325172 16:4937564-4937586 ACTCAGATGGTGGCAATTGAGGG + Intronic
1133440316 16:5815849-5815871 ACTCAGATGGGGGCAGGGGCTGG + Intergenic
1134403921 16:13938693-13938715 CCTCAGACATTGGCAATGGAGGG + Intronic
1138006547 16:53342844-53342866 CCTCAGATGGCGGGAGAGGAAGG + Intergenic
1138168538 16:54826730-54826752 CCTCAGAGGGAGGTTGTGGATGG - Intergenic
1138522201 16:57577566-57577588 ACCCAGATGGTGGCAGGGGTGGG - Intronic
1138694352 16:58797866-58797888 CCTCATATGGTGGAAGGGGCAGG + Intergenic
1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG + Intergenic
1141876752 16:86830177-86830199 CCTCTGCTGGTGGCATGGGAGGG + Intergenic
1141899939 16:86984582-86984604 CATCTGATGGGGGCAGGGGAAGG + Intergenic
1142747997 17:1969911-1969933 AGTCAGATGGTGGCAGGGGCTGG + Intronic
1143335222 17:6167080-6167102 CCTGGGATGGTGGCAGTGGATGG + Intergenic
1143850689 17:9809471-9809493 CCTGAGAGGGTGGCTGTGGCGGG + Intronic
1144237359 17:13274510-13274532 CCTCTCATGGTGGAAGGGGAAGG - Intergenic
1144243699 17:13340808-13340830 CCTCATATGGCGGAAATGGAAGG - Intergenic
1145837529 17:27965862-27965884 CCTCACATGGTGGAAGGGGCAGG + Intergenic
1146053438 17:29569159-29569181 CCTCAGATGGTGACTGTGGAGGG - Intronic
1146559387 17:33855029-33855051 TCTGAGATGGGGGCAGGGGATGG + Intronic
1147907392 17:43832352-43832374 TCTTAGAAGGTTGCAGTGGAGGG - Intronic
1148763164 17:50019517-50019539 ACTCAGATGGCTGAAGTGGAAGG + Intergenic
1149272474 17:54995238-54995260 GCCCAAATGGTGCCAGTGGAAGG - Intronic
1149301980 17:55313776-55313798 CCTGAGGTGCTGGCAGAGGATGG - Intronic
1149852754 17:60050200-60050222 CCTCAGGTGGTGGAAGGGGCAGG - Intronic
1150418837 17:65011213-65011235 ATTCAGTTGGTGGCAGTGGTTGG - Exonic
1150807295 17:68329401-68329423 CCACTGAGGCTGGCAGTGGAGGG + Intronic
1151542295 17:74770760-74770782 CCCCAGATGATGGCAGGGCAAGG + Exonic
1152703067 17:81829041-81829063 CCTGAGGTGGTGGATGTGGAGGG + Intronic
1152907718 17:82977993-82978015 CCACAGGTGGTGGCAGTGGGTGG + Intronic
1153488580 18:5627012-5627034 GCTCAGAAGGTGGAACTGGAAGG + Intronic
1157967545 18:52225038-52225060 CTTCAGATGGTGGCAGAGAAGGG + Intergenic
1160014093 18:75127624-75127646 CCTAGGTTGGTGGCTGTGGACGG - Intergenic
1160082492 18:75742232-75742254 CCTCACATGGTGGCATGGCAGGG + Intergenic
1160434418 18:78834951-78834973 CCTCCGGGGGTGGCTGTGGATGG - Intergenic
1161398898 19:4059061-4059083 CGGCAGATGGTGGCAGGGGGTGG - Intronic
1161565233 19:4998142-4998164 CCTCGCCTGGGGGCAGTGGACGG + Intronic
1161686581 19:5705710-5705732 CCTAAGATGGGGGCTGAGGAGGG + Intronic
1162934599 19:13975429-13975451 ACTCTGAAGGTGGCAGGGGAGGG + Intronic
1164641602 19:29830130-29830152 CCTCAGGTGGTGGGAGTCAAGGG + Intergenic
1165223984 19:34341158-34341180 CCTCTAATGGTGGCACAGGAGGG - Intronic
1165879262 19:39031456-39031478 CCTGAGCTGGTGGGAGGGGAAGG - Intronic
1166390533 19:42406711-42406733 CCTCAGAGGGCGGGAATGGAAGG + Intronic
925387533 2:3472531-3472553 CCTCACAGGGTGGCAGGGGCTGG - Intronic
927210958 2:20638726-20638748 CCTCAGATCCTGGCATGGGAGGG - Intronic
927509546 2:23635851-23635873 TCCCAGATGATGGCAGTGGGAGG + Intronic
927510563 2:23641491-23641513 CCTCTGAGGGAGGCAGGGGAAGG - Intronic
927676473 2:25110183-25110205 CCCCGGAGGGTGGCAGAGGAAGG - Intronic
929119879 2:38475933-38475955 CCTCAGATGATGCCAGTGCATGG - Intergenic
930387211 2:50711873-50711895 CCTCACTCAGTGGCAGTGGAAGG - Intronic
931083624 2:58804234-58804256 CCTCACATGGTGGCAGGCAAAGG + Intergenic
931625196 2:64250927-64250949 CCTCAGGTGGTGCCAGTTGGTGG + Intergenic
932959976 2:76402239-76402261 CCACAGGTGGTGGCAGGGTATGG - Intergenic
934324489 2:91999784-91999806 CCTAAGCAGGTGGCAGAGGAAGG + Intergenic
934462864 2:94230477-94230499 CCTAAGCCGGTGGCAGAGGAAGG + Intergenic
935024431 2:99262799-99262821 CCACAGATGATTGCTGTGGAGGG + Intronic
935524426 2:104148032-104148054 CCTCACATGGTGGAAGGGGCTGG - Intergenic
936009765 2:108918143-108918165 CCCCAGCTGGTGACAGTGGAAGG - Intronic
936148861 2:109999471-109999493 CCTAAGCAGGTGGCAGAGGAAGG - Intergenic
936195819 2:110371897-110371919 CCTAAGCAGGTGGCAGAGGAAGG + Intergenic
936249018 2:110853056-110853078 CAGCACATGCTGGCAGTGGAGGG - Intronic
937004365 2:118497616-118497638 ACTGAGATGGTGGTGGTGGATGG - Intergenic
937466207 2:122135207-122135229 CTTAGGATGGTGGCAGAGGATGG + Intergenic
938900195 2:135792926-135792948 CCGCAGCTGGTGGCAGTGGAAGG + Intronic
939229940 2:139411458-139411480 CCTCAGATGGCGGGGGTGGGAGG - Intergenic
941627442 2:167845121-167845143 CATCAGGTGGGGGCAGTGGGAGG - Intergenic
945572060 2:211480463-211480485 CTTCACATGGTGGCAGGGGAGGG - Intronic
945930458 2:215849743-215849765 CCTCAGTTGGTGACACAGGATGG + Intergenic
946989823 2:225315850-225315872 CCTAAAAGGTTGGCAGTGGAGGG + Intergenic
947632620 2:231663756-231663778 CCTCTGGTGGTGGAAATGGAGGG + Intergenic
948213302 2:236210798-236210820 CCTGTGAAGGAGGCAGTGGAGGG + Intronic
948317703 2:237041656-237041678 CCTCACATGGTGGAAGGGGCAGG + Intergenic
948795987 2:240402311-240402333 CCTGAGCTGGGGGCAGAGGAAGG - Intergenic
1170116573 20:12866364-12866386 CCTCTGATGGTGTCAGTGGAGGG + Intergenic
1170389331 20:15854683-15854705 CCTCACTTGGTGGGAGAGGAGGG + Intronic
1171046206 20:21810843-21810865 CTTGGGAAGGTGGCAGTGGATGG - Intergenic
1172493361 20:35359744-35359766 CCTCAGCTGGTGACAGAGTAAGG - Intronic
1173453562 20:43186514-43186536 CCTCTGATCGTGGCTGTGAAAGG + Intronic
1173839006 20:46144818-46144840 CCTCAGAAGGTGGGTGTGGCTGG + Intergenic
1173926019 20:46781824-46781846 CCACAGATGGGGGCAGGGAATGG + Intergenic
1174141037 20:48413746-48413768 CCGCTGATGATGGCAGTGGCAGG + Intergenic
1174160222 20:48545315-48545337 CCTGTGATGGGGGCACTGGAGGG - Intergenic
1174650416 20:52120101-52120123 CCACACATGGTGGAAGGGGAAGG - Intronic
1175455132 20:59106740-59106762 GTTCAGATGGTGGCACAGGATGG - Intergenic
1175828417 20:61949572-61949594 CCTCACATGGTGGAAGGTGAGGG + Intergenic
1176593919 21:8673529-8673551 CCTAAGCAGGTGGCAGAGGAAGG + Intergenic
1176691874 21:9921988-9922010 CCTCACATGGTGGAAGAGGGAGG - Intergenic
1176740467 21:10596738-10596760 CCTGAGATGGTGCCAGTGCTGGG + Intronic
1176927196 21:14764689-14764711 TCTCACATGGTGTGAGTGGAGGG - Intergenic
1180276773 22:10650656-10650678 CCTAAGCAGGTGGCAGAGGAAGG + Intergenic
1180697240 22:17759610-17759632 CCTCAGAAGGCTGCAGTGGGAGG + Intronic
1180745221 22:18083903-18083925 CCTCTGAAGTTGGCAGTGGAAGG + Intronic
1181585056 22:23848677-23848699 CCTCAGATGGGTGCACTGGGGGG - Intergenic
1182972477 22:34590893-34590915 AATCAGATGGTCACAGTGGATGG + Intergenic
1183403146 22:37616685-37616707 CCTGAGATTGTGGCAGGGCAGGG - Intronic
1183975197 22:41507985-41508007 AATCAGATGGTCACAGTGGATGG - Exonic
1184927163 22:47651005-47651027 CCTCACATGGTGTGAGTGGGGGG - Intergenic
949397909 3:3634756-3634778 CCTGAGACAGTGGCAGCGGAAGG - Intergenic
950807892 3:15623789-15623811 CTTCACATGGTGGCAGAAGATGG - Intronic
950890615 3:16400894-16400916 CCTTTGATGCTGGCAGGGGAGGG - Intronic
952050581 3:29379531-29379553 TCTCACATGGCGGCAGTGCAGGG + Intronic
952129331 3:30342006-30342028 ACACAGATGGAGACAGTGGAAGG - Intergenic
952899550 3:38100365-38100387 CTCCAGATGCTGGCAGTGCAGGG - Exonic
953113402 3:39966619-39966641 CCTCAGTTGGGGGCAGGGGGTGG + Intronic
953740475 3:45534315-45534337 CCTCAGATGCTGGGAGAGGCAGG - Intronic
954877204 3:53809972-53809994 CCTCAGATCATGGCAGTTGCCGG + Exonic
954993618 3:54862168-54862190 CCTCAGAGGGTTGCAGAAGAAGG + Intronic
955185590 3:56711900-56711922 CCTCACCTGGTGGTATTGGAAGG + Intergenic
955420010 3:58726602-58726624 CTTCTGATGGTGTGAGTGGAAGG - Intronic
956102689 3:65784940-65784962 CTTGAGAGGGTGGCGGTGGAGGG + Intronic
956211166 3:66803312-66803334 CATCACATGATGGCAGAGGATGG - Intergenic
956887608 3:73576179-73576201 CCTCAGTTTGGGGTAGTGGAGGG - Intronic
957113015 3:75991092-75991114 CATCAGATGGTGGGACTGGTTGG + Intronic
959671879 3:108987621-108987643 GCTGAGAGGGTGGGAGTGGATGG + Intronic
959770186 3:110085665-110085687 CCTCACATGGTGGAAGGGGCAGG - Intergenic
959839343 3:110956269-110956291 CCTCAGATGGTTCCAGTGTGTGG - Intergenic
960516550 3:118608357-118608379 CATCAGATGGTGGCAGAGCTAGG - Intergenic
962032483 3:131615974-131615996 CCTCAGAAGGGGGCTGTGGCGGG - Intronic
962405941 3:135100122-135100144 GGACAGAAGGTGGCAGTGGAGGG + Intronic
962752516 3:138444266-138444288 CCTCAGATGGGGAGGGTGGAGGG + Intronic
962926097 3:139994655-139994677 GATCAGAGGCTGGCAGTGGAGGG - Intronic
963989368 3:151635419-151635441 CCTCACATGGTGGAAGGGGAGGG + Intergenic
966003838 3:174983604-174983626 CCTCACATGGTGGAAGGGGCAGG + Intronic
966472120 3:180301728-180301750 GATCAGATGGTAGCAGTGGAAGG + Intergenic
966942899 3:184758145-184758167 CCTAGGATGGTGGCACTGAAGGG + Intergenic
967078108 3:186023532-186023554 CCTGAGAAGGTGGAAGTGGGTGG + Intergenic
969378443 4:6778573-6778595 CCTCAGAGGGTTGCGGTGAAGGG - Intergenic
971096386 4:23409316-23409338 CCTCAGACAGTGGCCATGGATGG + Intergenic
971248380 4:24950675-24950697 CCCCTTAGGGTGGCAGTGGAGGG + Intronic
971398595 4:26254095-26254117 CCCAGGATGGTGGCAGTAGAGGG - Intronic
971470618 4:27021976-27021998 CATCAGAGTATGGCAGTGGAGGG - Intronic
971648496 4:29239579-29239601 ACTGAGAAGGTGGAAGTGGAAGG - Intergenic
971774917 4:30950789-30950811 ACTCAGCTGGTGGCATTTGAGGG + Intronic
972447031 4:39154204-39154226 CTTCACATGGTGGCAGAAGAGGG - Intergenic
972664126 4:41147439-41147461 CCTCAAATGGTGGCAGTGTCTGG - Intronic
973597425 4:52506920-52506942 ACTGGGATGGTAGCAGTGGATGG - Intergenic
976287703 4:83386125-83386147 CTTCACATGGTGGCAGGGGAAGG + Intergenic
976496430 4:85735058-85735080 CCTGAAAAGGTGGGAGTGGAAGG - Intronic
980364460 4:131782191-131782213 CCTCACATGGTGGAAGAGGGAGG - Intergenic
981720543 4:147797336-147797358 AGTAAAATGGTGGCAGTGGAAGG - Intronic
982897651 4:160953656-160953678 GCTCAGGTGGTGACAGTGAATGG + Intergenic
983645734 4:169989646-169989668 CCTCAGATGGTGACAGAGTGAGG + Exonic
984290874 4:177792312-177792334 CATCACATGGTGGGAGAGGAAGG + Intronic
984356759 4:178669984-178670006 CCTCAGAAGGTGACAGTGTTTGG - Intergenic
985766874 5:1784734-1784756 GGTCAGATGGTGGCTGTGGCTGG + Intergenic
989692888 5:44166607-44166629 CTTCACATGGTGACAGTAGAGGG + Intergenic
991582813 5:68174465-68174487 CCTCACATGGTGGAAGGGCAAGG + Intergenic
993699098 5:91097237-91097259 CCTCACATGGTGGAAGGGGCAGG + Intronic
995310011 5:110699778-110699800 CCTCAGAGGGTGGTGGAGGAGGG - Intronic
998037968 5:138932630-138932652 GTTCAGCTGGTGGCAGTAGAGGG - Exonic
998153359 5:139769757-139769779 ACACTGATGGTGGCAGTGGGGGG + Intergenic
998423285 5:142006515-142006537 CCACAGATGGTGGTACTGGGTGG - Intronic
998681456 5:144472322-144472344 GTTCAGAGGGTGGAAGTGGAGGG + Intronic
998822060 5:146066101-146066123 CCACAGATGATGGCAGAGCAAGG + Intronic
1000975844 5:167763434-167763456 TCTCAGATGGTTGCAGTGCTTGG - Intronic
1001301646 5:170537874-170537896 CCTCAGATTGGGGAATTGGAAGG - Intronic
1003946213 6:11078263-11078285 CCTCACATGGTGGAAGGGCAAGG - Intergenic
1005527494 6:26665315-26665337 CCACAGATGGTGGAGGGGGATGG - Intergenic
1006166703 6:32069669-32069691 CCCCAGGTGGTGCCCGTGGAGGG - Intronic
1006166830 6:32070243-32070265 CCCCAGGTGGTGCCCGTGGAGGG - Intronic
1006169402 6:32084529-32084551 CCCCAGGTGGTGCCCGTGGAAGG - Intronic
1007109186 6:39303351-39303373 GCCCAGCAGGTGGCAGTGGAGGG - Intronic
1007238581 6:40408970-40408992 CCTCACATGGCAGCAGTGGAAGG + Intronic
1007259547 6:40554075-40554097 TCCCAGGTGGTGGCAATGGAGGG - Intronic
1007286612 6:40752454-40752476 CCTCAGAAGGCAGGAGTGGAAGG - Intergenic
1007389052 6:41539411-41539433 TCTCAGCTGCTGGCACTGGAGGG - Intergenic
1009947413 6:70355908-70355930 CCTCACATGGTGGAAGGGCAAGG - Intergenic
1011626640 6:89288474-89288496 AGTCAGATGGTGGCAGCTGATGG - Intronic
1011990124 6:93504590-93504612 CATCAGTTGGTGGCACAGGAAGG + Intergenic
1013426876 6:110020144-110020166 CTTTAGATGGTAGCTGTGGATGG - Intergenic
1015169890 6:130240762-130240784 CCTCACATGGTGGAAGGGCAAGG - Intronic
1015819583 6:137246031-137246053 CCACAGATGAGGGCAGGGGATGG + Intergenic
1016838976 6:148507024-148507046 CGTCAGATGGTGGCAGGGGAAGG + Intronic
1017099877 6:150838959-150838981 CCCCAGACAATGGCAGTGGAGGG + Intronic
1017584367 6:155904049-155904071 CCTGGGATGATGGCAGAGGAAGG + Intergenic
1017595645 6:156025901-156025923 CCTCACATGGTGGAGGGGGAGGG - Intergenic
1018632122 6:165830454-165830476 CCTCATATGGAGGCAGAGGCTGG - Intronic
1018931555 6:168243290-168243312 CCTCAGGTTGGGGCAGTGGCTGG - Intergenic
1019034422 6:169042483-169042505 TCTCAGCTGCTGGCAGTGAAGGG + Intergenic
1019215081 6:170438324-170438346 CCTGAGATAGTGACACTGGAAGG + Intergenic
1022286232 7:28957798-28957820 CCCCAGACGGTGGAAGTCGAAGG + Exonic
1022354212 7:29596824-29596846 CCTCACATGGTAGCAGGGAAGGG + Intergenic
1022414489 7:30166401-30166423 CCTCAGATGGGGGCAGGGCTGGG + Intergenic
1023059049 7:36311947-36311969 CCTCAGCTTGTGGGAGTAGATGG + Intergenic
1025724120 7:64042320-64042342 CCTCAGGTGGTGCCAATGGAAGG + Intronic
1025724285 7:64043407-64043429 CCTCAGGTGGTTCCAATGGAAGG - Intronic
1025753240 7:64311582-64311604 CCTCAGATGGTGCCAATGGAAGG + Intronic
1026968619 7:74454768-74454790 ACTCAGAAGGTGGCAGTGGGGGG + Intronic
1026977033 7:74505337-74505359 CCTCAGATGGAGGGAGAGGCAGG - Intronic
1027314766 7:76978705-76978727 CTGCAGATGGTGGCACTGTAGGG - Intergenic
1027530495 7:79325238-79325260 GGTAAGATGGTGGGAGTGGAGGG - Intronic
1029972454 7:104802543-104802565 CCTCACATGGTGGAAGGGGAGGG - Intronic
1030352085 7:108500955-108500977 CCTCAGATGGTGGCAGTGGAAGG - Intronic
1031692817 7:124811670-124811692 CCACAGATGATGGTATTGGAAGG + Intergenic
1031791610 7:126113132-126113154 CTTCAGAAGATGACAGTGGAAGG - Intergenic
1033121264 7:138668742-138668764 CCCCGGAAGGTGGCAGGGGAAGG - Intronic
1034300105 7:150007969-150007991 CCTCAGATGGAGGTAGTGAGGGG - Intergenic
1034349422 7:150406422-150406444 GCTGGGATGGTGGCAGTGGGGGG + Intronic
1034374415 7:150629917-150629939 CCTCTGATGGTGGCTGAGGCGGG + Intronic
1034701006 7:153095833-153095855 CCTCTGATGTGGGCAGTGGGAGG - Intergenic
1035064895 7:156097179-156097201 CCACAGACGGTGGCGGTAGAGGG + Intergenic
1036422842 8:8613948-8613970 AGTCAGAGGGAGGCAGTGGAAGG + Intergenic
1036578223 8:10048265-10048287 GCTCTGATGGGGGCAGTGCAGGG + Intergenic
1036777289 8:11622377-11622399 CCTCAGCTGTTGGCAGTGAGGGG - Intergenic
1037179901 8:15992719-15992741 GCTGTGATGGTGGCAGTGGGTGG + Intergenic
1037778078 8:21848903-21848925 CTTCAGGAGGTGGCAGGGGATGG - Intergenic
1037952607 8:23028693-23028715 CCTGAGAAGGTGTCAGGGGAAGG + Intronic
1037963455 8:23116529-23116551 CCTGAGAAGGTGTCAGGGGAAGG - Intronic
1039083679 8:33758947-33758969 CCTCACATGGTGGTAAGGGAAGG + Intergenic
1039440342 8:37590809-37590831 CCTCAGATGGGAGCAGGGCATGG + Intergenic
1041260880 8:56019602-56019624 CCTCAGGTGGGGCCGGTGGATGG + Intergenic
1042811694 8:72832658-72832680 CCACAGATGCTGGCAGAAGACGG + Intronic
1043769830 8:84184314-84184336 TTTCAAATGATGGCAGTGGAAGG + Intronic
1046592317 8:116221192-116221214 CCCCATATGGTGGAAGGGGAGGG - Intergenic
1047110831 8:121787408-121787430 CCTCACAAGGTGGCAGAAGAGGG + Intergenic
1048355207 8:133648052-133648074 CCACTGATGGTGGAAGGGGAAGG - Intergenic
1048525141 8:135195778-135195800 TCACAGATGGTGGATGTGGACGG - Intergenic
1049059166 8:140262891-140262913 TTTCAGGAGGTGGCAGTGGACGG + Intronic
1049226607 8:141454760-141454782 GGTCAGAAGGTGGGAGTGGAGGG + Intergenic
1049420484 8:142514215-142514237 CCTGAGATGGTGGTAGAGGCGGG + Intronic
1049565487 8:143335815-143335837 AGTCAGTTGGTGGCAGGGGAGGG - Intronic
1050242929 9:3657950-3657972 CCTCCAGTGGTGGCAGTGGAGGG + Intergenic
1050354520 9:4770165-4770187 CCTCAGCTGGAGGCAGAGGTTGG - Intergenic
1050651248 9:7779154-7779176 ACTCAGAGGGTGGAAGTGGAGGG + Intergenic
1051660314 9:19419995-19420017 CCCCAGATGGTGGCAGAGGCAGG + Intronic
1052295496 9:26892719-26892741 CCTCCGATGGTTGCAGCAGAGGG - Exonic
1052512109 9:29435088-29435110 CCATGGATGGTGGTAGTGGAGGG + Intergenic
1053628811 9:39908081-39908103 CCTCACATGGTGGAAGAGGGAGG - Intergenic
1053777257 9:41558263-41558285 CCTCACATGGTGGAAGAGGGAGG + Intergenic
1053940058 9:43239146-43239168 CCTAAGCCGGTGGCAGAGGAAGG + Intergenic
1054215076 9:62342621-62342643 CCTCACATGGTGGAAGAGGGAGG + Intergenic
1054364475 9:64320223-64320245 CCTCACATGGTGGAAGAGGGAGG - Intergenic
1054672405 9:67812728-67812750 CCTCACATGGTGGAAGAGGGAGG - Intergenic
1055467753 9:76582374-76582396 CCTGAGATGGCTGCAGTGAAGGG + Intergenic
1056496282 9:87158431-87158453 CAGCACATGGTGGCAGGGGAAGG - Exonic
1056667159 9:88589989-88590011 CCTCAGATGGGCACAGTGGGTGG - Intergenic
1056825807 9:89875655-89875677 CCACAGATGGGGGCGGTGCATGG - Intergenic
1057512921 9:95695801-95695823 CTTCACATGGTGGCAGGAGAGGG - Intergenic
1059660391 9:116394397-116394419 CCTAAGATCATGACAGTGGAGGG + Intronic
1059793801 9:117668694-117668716 CCTCAGAGTATGGCAGTGGGTGG + Intergenic
1060259358 9:122060498-122060520 GCTCAGATGTTGGAACTGGAAGG - Intronic
1061053993 9:128212156-128212178 CCTGAGATCCTGGCTGTGGAAGG - Intronic
1061667019 9:132166494-132166516 TCTCAAATTGTGACAGTGGATGG - Exonic
1061896757 9:133652310-133652332 CCCCAGCTGGTGGCAGTGAGTGG - Intronic
1062033559 9:134372736-134372758 CCTCAGAGGGTGGCAGCACAGGG + Intronic
1062190416 9:135245159-135245181 GCTCAGAAGGTGGCACTGGCCGG + Intergenic
1062271959 9:135713923-135713945 CCTCACCTGGTGACAGTGGCAGG + Intronic
1187280164 X:17852479-17852501 TCTCAGAGGCTGGCAGGGGAGGG + Intronic
1187720730 X:22148165-22148187 AGTCAGATGGTGGCTGTGGCTGG + Intronic
1188114162 X:26223347-26223369 ACTGAGATGGTGGCAGGGGCTGG - Intergenic
1188983094 X:36745286-36745308 CAGCAGATGATAGCAGTGGAGGG + Intergenic
1189883608 X:45516712-45516734 TCTCAGGTGGTTGCAGTAGATGG - Intergenic
1190338957 X:49281326-49281348 GCTCAGAAGGTGCCAGTGGGTGG + Intronic
1190463069 X:50698256-50698278 ACTCAGATAGTGGCAGCTGAAGG - Intronic
1190481380 X:50880472-50880494 CCTCACATGGTGGGAGGTGAGGG + Intergenic
1192537471 X:71940552-71940574 CCTGAGATGGTGGGAGGAGATGG + Intergenic
1192720081 X:73685927-73685949 CAGCAGATGATAGCAGTGGAGGG + Intronic
1193366822 X:80644281-80644303 ACTCAGATGGTGTCCATGGAGGG - Intergenic
1194669304 X:96710659-96710681 CATCATATGGTGGGAGTGGAGGG - Intronic
1194720753 X:97337495-97337517 CTTCACAGGGTGGCAGGGGAGGG - Intronic
1201868029 Y:18675433-18675455 CCTCAGTTTATGTCAGTGGAAGG + Intergenic
1202028013 Y:20544799-20544821 CCTTGGATGGTTACAGTGGATGG + Intergenic
1202046222 Y:20739229-20739251 CATCAGATAGTGGGAGTGTATGG + Intergenic