ID: 1030356269

View in Genome Browser
Species Human (GRCh38)
Location 7:108546392-108546414
Sequence TTCCAGGTGTACACACCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030356269_1030356273 15 Left 1030356269 7:108546392-108546414 CCAGTTGGTGTGTACACCTGGAA 0: 1
1: 0
2: 1
3: 8
4: 79
Right 1030356273 7:108546430-108546452 CTGGTTCTTCAGTGATACATAGG No data
1030356269_1030356272 -4 Left 1030356269 7:108546392-108546414 CCAGTTGGTGTGTACACCTGGAA 0: 1
1: 0
2: 1
3: 8
4: 79
Right 1030356272 7:108546411-108546433 GGAACAGGTGATATTTGAACTGG 0: 1
1: 0
2: 8
3: 59
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030356269 Original CRISPR TTCCAGGTGTACACACCAAC TGG (reversed) Intronic
901174104 1:7286015-7286037 TTTCAGATGTACCCACCACCGGG + Intronic
904091037 1:27945294-27945316 TTCCAGGTGTGCCCATCAGCTGG + Exonic
912194989 1:107387260-107387282 TTCTAGCTGTACTCACAAACTGG - Intronic
915275128 1:154783333-154783355 TCCCTGGTGTCCACACCACCTGG + Intronic
917520964 1:175748224-175748246 TTCCAGGTGGAGACACTATCTGG + Intergenic
918232489 1:182548799-182548821 TTCCAGAAGTACATAACAACGGG - Exonic
921884485 1:220291615-220291637 TTCCTGGTGTACACAGCAGTGGG - Intergenic
923070770 1:230562541-230562563 TTCCAGGTGTCCTCTCCCACTGG - Intergenic
923289000 1:232526295-232526317 TGAGAGGTGTACACACCATCTGG - Intronic
923335566 1:232966903-232966925 TCTGGGGTGTACACACCAACTGG - Intronic
1067364541 10:45612895-45612917 TTCAATGTGTACACACAAAGTGG - Intergenic
1070468723 10:76754982-76755004 TTCCATGTGTACATCCCCACTGG - Intergenic
1071321760 10:84467096-84467118 TTCCAAGTTTTCACACTAACTGG - Intronic
1076114133 10:127883707-127883729 TTCCAGGTGTACACCCCCGTCGG + Exonic
1078027296 11:7709145-7709167 TCCCAGGGGAAAACACCAACTGG + Intergenic
1083641677 11:64149049-64149071 TCCCAGGAGAACACACCAAGAGG + Intronic
1085146576 11:74204556-74204578 TTCCAGGCATACACACAGACTGG + Intronic
1087685040 11:101252742-101252764 TTCCAGCTGTACACACAATTTGG + Intergenic
1088791684 11:113232190-113232212 TCCCAAGTGTACACAGCCACAGG - Exonic
1090225107 11:125065562-125065584 TTCCAGGTTTACAAGCCAAAAGG - Intronic
1092657212 12:10698896-10698918 TTCCAGCTGTACATTTCAACAGG + Intergenic
1095089112 12:38087646-38087668 TTCCAGGTGTATACACTCATGGG - Intergenic
1105916440 13:24921382-24921404 TTCCAGGCGTACAGACCAGGTGG - Intronic
1120963905 14:90150618-90150640 TTTCAGGTGTACATGCTAACAGG + Intronic
1121055726 14:90850677-90850699 TTCCTGGTGACCTCACCAACAGG - Exonic
1122709516 14:103645340-103645362 TACCAGGTCTACAAACCAAGTGG + Intronic
1125589605 15:40846053-40846075 TACTAGGTATACATACCAACAGG - Intronic
1126712045 15:51469895-51469917 TTCCAGGTTTACACTCTATCAGG - Intronic
1127127988 15:55832008-55832030 TTCCAGTTTTATACATCAACTGG + Intronic
1127247797 15:57196568-57196590 TTCCAGGTTTACACAAAAAATGG - Intronic
1133262348 16:4559165-4559187 ATCCAGCTGGACACACCAACGGG - Intronic
1133547267 16:6819563-6819585 TTACAGGCATACACGCCAACAGG - Intronic
1144314177 17:14043553-14043575 TTCCAGGTGGAAAAACCAAGAGG - Intergenic
1148707434 17:49647996-49648018 TTTCAGGTGTCCATACTAACTGG + Intronic
1158698638 18:59726278-59726300 TTCCTGGTATACACACTAACAGG + Intergenic
927413081 2:22848671-22848693 TTCCAGGTAGTGACACCAACAGG + Intergenic
927512943 2:23655797-23655819 TTCCAGGTCTACACACCTCCTGG - Intronic
931969046 2:67565929-67565951 TTCCAAATGCACACAGCAACTGG + Intergenic
935707547 2:105870085-105870107 TTCCTGGTGTGCCCACCCACTGG + Intronic
941998877 2:171626892-171626914 TTCCAGGTGTGGACTCCACCTGG - Intergenic
942099267 2:172562534-172562556 CTCCAGGTGAACAGTCCAACTGG - Intronic
943218240 2:185067498-185067520 CTCCAGGTGGACACACCCTCAGG + Intergenic
943811747 2:192195750-192195772 TCCCAGGTGGACACACTAATAGG - Intergenic
946579948 2:221117559-221117581 GTCTAGGTGGACACACCAGCTGG + Intergenic
1170811215 20:19676354-19676376 TTCCAGCTGTTCAAACCAGCAGG + Intronic
1175452857 20:59084708-59084730 TTGCAGCTGTACACTCAAACCGG + Intergenic
1179004931 21:37505277-37505299 TTACAGGAGTACAAACCACCAGG + Exonic
954678340 3:52327656-52327678 TCCCAGGGGTACACAGCATCTGG - Intronic
955159657 3:56451884-56451906 TTTCTGGTGTTCACAGCAACTGG - Intronic
955683431 3:61526408-61526430 TTCCAGGTGAGCACAACAGCGGG + Intergenic
960415775 3:117383278-117383300 TTCGAGAGGAACACACCAACAGG + Intergenic
963031707 3:140985177-140985199 TGCCAGGTTTTCACACCTACTGG - Intergenic
966967295 3:185006764-185006786 TTCTAGGTGTAGACAGCAACAGG - Intronic
970640837 4:18064281-18064303 TTCCAGTTGTCCACTCCAAGTGG - Intergenic
974326352 4:60419498-60419520 TTCCGGGTGCCCACACCACCAGG - Intergenic
974787389 4:66636781-66636803 TTCCTGGTGTGAACACCATCAGG + Intergenic
978591626 4:110330128-110330150 TTCCAGGTGTACAGTGCAAGCGG - Intergenic
982082171 4:151801041-151801063 CTCCTGGTGTACACACCTCCTGG - Intergenic
994199218 5:96953235-96953257 ATCCAGGTGTTCACACATACCGG + Intronic
997445817 5:133939403-133939425 TTCCAGGTGTAGTCAGGAACCGG + Intergenic
999191012 5:149747623-149747645 TACCTGGTGTCCACACCCACAGG - Intronic
1002255728 5:177957372-177957394 TTCCAGCTGTACACTTCCACTGG - Intergenic
1002901406 6:1412589-1412611 CTCCAGGTGAACAAACCCACAGG + Intergenic
1008677015 6:53829787-53829809 TCCCAGGTGTTCAGACCAAAGGG - Intronic
1012469423 6:99554353-99554375 TTCCATATGTACACACTAGCAGG + Intronic
1013471674 6:110472036-110472058 TTCCAGGTGGAGACATCAAGTGG - Intronic
1015951681 6:138559404-138559426 TTCAAGGCTTATACACCAACGGG + Intronic
1016557636 6:145357150-145357172 TTAAAGGTTTACACACCCACTGG - Intergenic
1019289358 7:242835-242857 CTCCAGGTGCCCACACCAAGGGG + Intronic
1028197326 7:87921969-87921991 TTACAGGTGTGCACAACACCCGG - Intergenic
1028430493 7:90741361-90741383 TTCCAGGTGTATACAGCACAAGG - Intronic
1030356269 7:108546392-108546414 TTCCAGGTGTACACACCAACTGG - Intronic
1035016198 7:155768534-155768556 CTCCTGGTGTAGACACCACCTGG - Intronic
1036768457 8:11563555-11563577 TGCCAGGTGCACACAGCAGCAGG - Intronic
1039453690 8:37695182-37695204 TTCCAAGTGAACACACCAAGGGG + Intergenic
1047324548 8:123824076-123824098 TTCCAGGTGAACTCACCAACAGG - Intergenic
1050306730 9:4312483-4312505 TTCCAGTTGTACACATAAACAGG + Intronic
1050441722 9:5670959-5670981 CTCCACGTGGACCCACCAACTGG - Intronic
1051528980 9:18078793-18078815 TTGTAGTTGTACAAACCAACTGG - Intergenic
1053067182 9:35076990-35077012 GTCCAGGTGTACACAGCACTGGG - Exonic
1053514854 9:38722143-38722165 GTAGAGGTGTACATACCAACTGG + Intergenic
1057245260 9:93450124-93450146 TTACAGGCGCACACACCACCAGG + Intronic
1058637420 9:107049883-107049905 ATCCAGGTATACACACCCACAGG - Intergenic
1059599836 9:115764985-115765007 TCCCAGCTGTAGACACAAACAGG - Intergenic
1061800625 9:133111809-133111831 TCCCAGATGTGCACACCATCTGG - Intronic
1186522038 X:10214510-10214532 TTTCAGGTGTACCAACCATCCGG + Intronic
1186793932 X:13025551-13025573 TTTCATGTGTAAACACCAACTGG - Intergenic
1187343521 X:18442369-18442391 GTCCAGCTGTACTCTCCAACAGG + Exonic
1197616474 X:128697516-128697538 TTCTAGGTTTCCTCACCAACTGG + Intergenic