ID: 1030356271

View in Genome Browser
Species Human (GRCh38)
Location 7:108546408-108546430
Sequence GTTCAAATATCACCTGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 6, 3: 49, 4: 322}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030356271_1030356273 -1 Left 1030356271 7:108546408-108546430 CCTGGAACAGGTGATATTTGAAC 0: 1
1: 0
2: 6
3: 49
4: 322
Right 1030356273 7:108546430-108546452 CTGGTTCTTCAGTGATACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030356271 Original CRISPR GTTCAAATATCACCTGTTCC AGG (reversed) Intronic
901590692 1:10339328-10339350 ATTCAAATGTCACCTCTTCCAGG - Intronic
901752150 1:11416910-11416932 GCTCAAATGTCACCTCTTCCTGG + Intergenic
902669166 1:17960672-17960694 AGTCAAATCTCACCTCTTCCTGG + Intergenic
902697861 1:18152405-18152427 GCTCAAATATCACCTTCTCAAGG - Intronic
902829978 1:19006119-19006141 GGTCAGATATCACCTCTGCCAGG + Intergenic
903125814 1:21246948-21246970 ATACAAATATCACCTGTGGCCGG - Intronic
903613680 1:24636233-24636255 GTTTAGATATGACCTCTTCCAGG - Intronic
904393219 1:30199332-30199354 GATCCCATTTCACCTGTTCCAGG - Intergenic
904459783 1:30669417-30669439 GGTCAAACATCACCTATTCAAGG + Intergenic
904483461 1:30808207-30808229 GTTCAAATATCACCTCTTCTAGG - Intergenic
904746352 1:32713560-32713582 GCTTAAATATCACTTTTTCCAGG + Intergenic
904796952 1:33063427-33063449 GTTCAAATGTCACCTTCTCAAGG - Intronic
905283400 1:36863656-36863678 GCTCAAGTATCACCTCTTCCAGG + Intronic
906429803 1:45746934-45746956 GTTCAAATATAACTTCCTCCAGG + Intronic
906610925 1:47201825-47201847 GTTCAAGTGTCACCTCTTCCTGG - Intergenic
906942041 1:50263981-50264003 GTTCAGGAGTCACCTGTTCCAGG + Intergenic
906951974 1:50342145-50342167 GCTCAAATGTCACCTGTTCTAGG + Intergenic
907051633 1:51333586-51333608 GTTCAGATGTCACCTCTTCCAGG + Intronic
907114786 1:51959166-51959188 GTTCAAGTATCATCTCTTCTGGG - Intronic
907372404 1:54011876-54011898 GTTCAAATGTTACCTCCTCCAGG - Intronic
907870609 1:58439250-58439272 CTTCAAGTATCACCTCCTCCAGG + Intronic
907887792 1:58609497-58609519 ATTAGAATATCACCTCTTCCAGG + Intergenic
907929112 1:58982541-58982563 GCTCAAGTGTCACCTCTTCCAGG - Intergenic
908867688 1:68569789-68569811 ATACGAACATCACCTGTTCCAGG - Intergenic
909062724 1:70897695-70897717 GTTAAAAGCTCACCTGCTCCAGG + Intronic
909187982 1:72513913-72513935 GTTCAAATATCACCTACTCCAGG + Intergenic
909853962 1:80504877-80504899 GTTCAGGTATCACCTCCTCCAGG - Intergenic
910931816 1:92450223-92450245 ATTAAAATATCACATGTGCCAGG - Intergenic
911439717 1:97910047-97910069 GTTCAAATGTCACCTCTACAGGG + Intronic
912507737 1:110167691-110167713 GCTCAAATATCAGCAGTTTCAGG - Intronic
913148271 1:116013828-116013850 CTTCAAATAATACCTGTTCATGG + Intronic
913319928 1:117581070-117581092 GCTCAAATGTCACCTCCTCCAGG - Intergenic
913674185 1:121125926-121125948 GCTCAGATATCACCTCCTCCTGG + Intergenic
914025969 1:143913247-143913269 GCTCAGATATCACCTCCTCCTGG + Intergenic
914664406 1:149820967-149820989 GCTCAGATATCACCTCCTCCTGG + Intergenic
914671357 1:149872868-149872890 GCTCAGATATCACCTCCTCCTGG - Intronic
916247126 1:162699387-162699409 TTCCAAATATCACCTGTTTAAGG + Intronic
916638944 1:166705708-166705730 GCTCATATATCACCTATTCAGGG - Intergenic
917242743 1:172966605-172966627 TTTTTAATATCACTTGTTCCAGG - Intergenic
918102952 1:181392329-181392351 GTTCAAACCTCACCTCTTCCAGG + Intergenic
918205960 1:182309761-182309783 GCTCAAATATCACCTCCTCCAGG - Intergenic
918361201 1:183759867-183759889 GCTCAAGTATCACCTCTTCCAGG + Intronic
918387989 1:184029797-184029819 CTTCATATAACACCTGTTCCAGG - Intronic
918629297 1:186696467-186696489 GTTCAAATATCATATCTCCCAGG + Intergenic
920709872 1:208285162-208285184 GTTCAGATATTACCTCCTCCAGG - Intergenic
920724397 1:208420215-208420237 GGTCAAATAGCACCTCCTCCAGG - Intergenic
920821765 1:209388155-209388177 GCTCAAACATCACCTCCTCCAGG + Intergenic
921361664 1:214335445-214335467 CTTCGGAAATCACCTGTTCCAGG - Intronic
923264771 1:232304000-232304022 GTTCAAATTTCAGCTGTACCAGG + Intergenic
1065412550 10:25445233-25445255 GTTCAAATATCATATTTTCTAGG - Intronic
1066600489 10:37100758-37100780 GTTCAAATATCATCTCTTTAAGG - Intergenic
1069202583 10:65640072-65640094 GTTCAAAAATCTCCTGTATCAGG - Intergenic
1069603399 10:69724353-69724375 ATTCAAATATCACCTCCCCCAGG - Intergenic
1070497203 10:77035296-77035318 GCTCAAATGTCATCTCTTCCAGG + Intronic
1070736902 10:78869322-78869344 GCTCAAATATCACCTACTCCAGG + Intergenic
1070848411 10:79542705-79542727 GTTCAAATTCCAGCTCTTCCAGG - Intergenic
1070925370 10:80217464-80217486 GTTCAAATTCCATCTCTTCCAGG + Intergenic
1073172050 10:101518809-101518831 GTTAAAATGTCACCTTTTTCAGG + Intronic
1073632494 10:105162520-105162542 GTTCAAAGATCAACTCCTCCTGG + Intronic
1074274939 10:111992285-111992307 GCTTATATATCACCTCTTCCAGG + Intergenic
1074593674 10:114840081-114840103 TTTCAAAGATGACCTCTTCCAGG - Intronic
1076458862 10:130624444-130624466 TTTCAAATATCACTTCTCCCAGG + Intergenic
1077687828 11:4314299-4314321 ATTCAAATATGAGCTGTCCCAGG + Intergenic
1078366586 11:10711600-10711622 GTTCAAATGTCACCTTATGCAGG + Intergenic
1078447891 11:11418502-11418524 GTTCAAATGCCAGCTTTTCCAGG + Intronic
1078760588 11:14248239-14248261 GTTCACAGCTCACCTGCTCCGGG - Intronic
1079013965 11:16853467-16853489 GTTCAAATATCACTTCCTCCGGG + Intronic
1079087483 11:17457045-17457067 GCTCAAATGTCACCTGCTCCAGG - Intronic
1080517989 11:33040836-33040858 GTTCAAATGTCATCTTTTCTGGG + Intronic
1080586827 11:33690106-33690128 GCTGAAGTATCACCTATTCCAGG - Intergenic
1080688147 11:34533060-34533082 GTTCAAAAATGAAATGTTCCAGG + Intergenic
1081729786 11:45362420-45362442 GCTCAAATATCACCTCTTTAGGG + Intergenic
1082756032 11:57077552-57077574 GTTCAAATGTCACCTTCTCAAGG - Intergenic
1083254693 11:61488953-61488975 GTTCAAACGTCACCTGCTCAAGG - Intronic
1083455152 11:62773810-62773832 GTTCAAATGTCACTTGCTCAGGG - Intronic
1085027016 11:73242383-73242405 GTTGAATGATCACATGTTCCAGG + Intergenic
1085621833 11:78043638-78043660 GTCAAAATGTCACCTGCTCCAGG - Intronic
1085717657 11:78887314-78887336 GCTCAAACATCACCTTTCCCAGG + Intronic
1085855571 11:80172049-80172071 GTTTAAATATCACCTCCTCAAGG + Intergenic
1086046331 11:82536225-82536247 GTTCAAATGTTACCTTTTCGAGG - Intergenic
1086386445 11:86313808-86313830 GCTCCAATATCACCTCCTCCAGG - Intronic
1086948533 11:92867703-92867725 GTTCCAAGATCTCCTATTCCTGG - Intronic
1087573984 11:99967038-99967060 ACTCAGATATCACCTCTTCCAGG - Intronic
1087630441 11:100644532-100644554 GCTCAAACATCACCTCCTCCAGG - Intergenic
1088089310 11:106019594-106019616 GTTTAAATGTCTTCTGTTCCAGG + Intronic
1088808997 11:113377178-113377200 GCTCAGACATCACCTCTTCCAGG - Intronic
1089071439 11:115702375-115702397 GGTCAAAGATCAACTTTTCCTGG + Intergenic
1089711125 11:120315418-120315440 TTTTAAAGCTCACCTGTTCCAGG - Exonic
1089907871 11:122063583-122063605 GTTAAAATATCACTTCTTTCAGG - Intergenic
1090787740 11:130065139-130065161 GTTCAAGTGTCACCTGCTCAAGG - Intergenic
1090938307 11:131365199-131365221 ATTCAGACATCACCTGTGCCTGG + Intergenic
1093822756 12:23642428-23642450 GCTTAAACATCACCTTTTCCTGG - Intronic
1094043547 12:26142895-26142917 TTTCCAATGTCACCTCTTCCAGG + Intronic
1094097713 12:26726791-26726813 TTTCAAATATCACTTTTTCATGG + Intronic
1094722769 12:33082079-33082101 GTTAAAATATCACCTTGTCTTGG - Intergenic
1095722190 12:45412853-45412875 GTTCAAATATCACCTGCTCAAGG - Intronic
1095729649 12:45492767-45492789 GCTAAAATATCACCTCTTCAGGG - Intergenic
1096680233 12:53251156-53251178 GTTCAAATGTCACCTGATCTTGG - Intergenic
1098714570 12:73813763-73813785 GTCCAAACTTCACCTGTTCTGGG - Intergenic
1098826554 12:75305316-75305338 GTGCAAATATCTCCTCTTCTAGG - Intronic
1098957072 12:76698570-76698592 GCTCAAATATCACTTCTTCATGG + Intergenic
1099326437 12:81221704-81221726 GTTCAAATTTGACCTGTTCAAGG + Intronic
1100314157 12:93428357-93428379 GTTCAAATATCTCCTGGGTCTGG + Intronic
1102122245 12:110450549-110450571 TTTCAAATGTCACCTTTTCAGGG + Intergenic
1102329575 12:112017417-112017439 GTTCAAATGTCCCCTGCTACTGG - Intronic
1102592055 12:113963930-113963952 GTTCAATCATCTCCTATTCCAGG + Intronic
1102680641 12:114688189-114688211 GTTCATATATGAACTTTTCCTGG + Intergenic
1102876022 12:116449387-116449409 GTGCAAATATCACCAGAACCTGG - Intergenic
1103823027 12:123713137-123713159 GCTGAAATATCACCTTCTCCGGG - Intronic
1105015221 12:132782553-132782575 GTTGAAAACTCACCTGTTTCTGG - Intronic
1106135759 13:26972250-26972272 GCTCAAATGCCACCTGCTCCAGG - Intergenic
1107959385 13:45544907-45544929 GTTCAGATTCCACCAGTTCCAGG + Exonic
1108485052 13:50915415-50915437 GCTCAAGTATCACCTCTACCAGG + Intronic
1110085679 13:71376290-71376312 GCTTAAATATCATCTCTTCCGGG + Intergenic
1110709738 13:78637125-78637147 GTTCAAAACTCACCCATTCCAGG + Intronic
1112744812 13:102514634-102514656 GTGGAAATATCACCTCTTCCTGG + Intergenic
1112894852 13:104286249-104286271 GTTCATCTAACACCTTTTCCTGG - Intergenic
1113326777 13:109289881-109289903 GTTCAAATTTCAGCTTTACCCGG + Intergenic
1114339572 14:21728988-21729010 GTTCAAATGTCAGCAGTTCAGGG - Intergenic
1114503631 14:23191012-23191034 CTGCAAATATCACCTGCTCAAGG + Intronic
1114878649 14:26755786-26755808 GTTCAAATTTCCCATATTCCTGG - Intergenic
1115061953 14:29202873-29202895 TTTCAAATGTCATCTGTTCAAGG - Intergenic
1115750965 14:36489337-36489359 GTTCAAATAGCAGCTGTGGCTGG - Intronic
1116057125 14:39877281-39877303 GTTCAAATATCAGTTTCTCCAGG + Intergenic
1116387705 14:44352186-44352208 ATTCAAATGTGACCTGTTCCTGG - Intergenic
1117836372 14:59810705-59810727 GTTCAGATATCATCACTTCCTGG - Intronic
1118512975 14:66496520-66496542 TTTCAAATGTCACCTGTCTCCGG - Intergenic
1118904572 14:70014341-70014363 GCTCAGATATCACCTTCTCCAGG - Intronic
1119519067 14:75272199-75272221 GCTCAAATGTCACCTTCTCCAGG - Intergenic
1119734705 14:76974563-76974585 GTTCAAATTTCATCTCCTCCAGG - Intergenic
1121857595 14:97284202-97284224 GCTCAAATGCCACCTCTTCCTGG + Intergenic
1125248387 15:37670512-37670534 GTTGATATTTCACCTTTTCCAGG + Intergenic
1126558860 15:50021566-50021588 GTTCAAATATTACCTCTTCAAGG + Intronic
1126791214 15:52222860-52222882 CTTCAAATCTCACCTTTTCAAGG - Intronic
1126868764 15:52964870-52964892 TTCCAAATATCGCATGTTCCTGG + Intergenic
1127135084 15:55911403-55911425 GTTCAAATGTCACCTCCTCTGGG + Intronic
1127308058 15:57727545-57727567 GTTCAAATGTCACCTTATCAGGG + Intronic
1127657007 15:61065092-61065114 GCTCAAATGTCACTTCTTCCAGG + Intronic
1128833661 15:70791784-70791806 GTTCAAATCCCACCTTTTGCAGG - Intergenic
1129085677 15:73088437-73088459 GGTCAAATATCAGCTATTTCAGG - Intronic
1130981176 15:88812648-88812670 GTTCAAATGTCACCTCCTCTTGG + Intronic
1131472446 15:92708838-92708860 GCTCAAACATCACCTCCTCCAGG + Intronic
1131778395 15:95827289-95827311 GCTCAAATATCACCTCTTCCAGG - Intergenic
1132370198 15:101291663-101291685 GTTTAAATTTCCCCTATTCCAGG - Intronic
1133157049 16:3882568-3882590 GTTCAAATGTCACCTACTCCAGG + Intergenic
1133638072 16:7689325-7689347 CTTCAAAGCTCACCTGTCCCAGG - Intronic
1134019326 16:10910593-10910615 GTGCAGATATCACCTCCTCCAGG - Intronic
1134416009 16:14043980-14044002 GTTCAGATGTCACCTCCTCCAGG - Intergenic
1135900533 16:26455483-26455505 TTTCAAATATCCCCCGTTCTTGG - Intergenic
1136069263 16:27778310-27778332 GCTCAAACATCACCTCCTCCGGG - Intronic
1137382244 16:48010262-48010284 GCTCAGAAATCACCTTTTCCAGG - Intergenic
1138200518 16:55084864-55084886 GTTCAAAAGTCACCTCTTCAGGG - Intergenic
1138241709 16:55432724-55432746 GTTGAAATGTCATCTCTTCCAGG - Intronic
1138320294 16:56105800-56105822 GCTCAAATATCACTTCTTCAGGG - Intergenic
1138325481 16:56162509-56162531 GCTCAAATATTACCTCTTTCAGG + Intergenic
1138605028 16:58083204-58083226 ATTCAAATGTCACCTTTTCTGGG + Intergenic
1139017945 16:62712633-62712655 GTTCAAATAATGCCTGTTTCGGG + Intergenic
1141158810 16:81615845-81615867 GTTTAAAGATCACCTGATTCAGG - Intronic
1143660923 17:8324228-8324250 GTTCAAATGTCATCTCTTCCAGG - Intergenic
1146647411 17:34584335-34584357 GTTCAAATGTCACCTCCTCCAGG + Intronic
1146951355 17:36908766-36908788 GTTCACCTGTCACATGTTCCTGG - Intergenic
1147623320 17:41882820-41882842 GTTCAAACATCACCTTCTCAGGG + Intronic
1148106798 17:45123260-45123282 GTTCAGATATCACCTCCTCCAGG + Intronic
1149270230 17:54969065-54969087 GTTCAAGTATCACCTCTCTCAGG + Intronic
1150605559 17:66687727-66687749 CTTTAAATGTCACCTTTTCCAGG - Intronic
1152330407 17:79669421-79669443 ATTCAAATGTCACCTCCTCCAGG - Intergenic
1156973974 18:43193900-43193922 GTTCAAATTACACCTTTTACAGG + Intergenic
1157420731 18:47545740-47545762 GCTCAAATACCACCTCTGCCAGG - Intergenic
1157681927 18:49614066-49614088 GTTCAGATGTCACCTCCTCCAGG - Intergenic
1158419468 18:57279998-57280020 GCTCAAATGTCTCCTCTTCCTGG + Intergenic
1158780227 18:60640302-60640324 ATTCAAATATCACCTTTTATTGG - Intergenic
1158875192 18:61727100-61727122 GCTCAAACATCACCTCCTCCAGG + Intergenic
1159768517 18:72520393-72520415 TTCCAAATATCTCTTGTTCCTGG - Intergenic
1160382312 18:78469539-78469561 TTTCAAACATCCCATGTTCCAGG + Intergenic
1161377202 19:3946089-3946111 GTTCAAATATCAGCTCTGCTGGG - Intergenic
1161871689 19:6875397-6875419 GTGTAAATATCACCTCCTCCAGG - Intergenic
1162078673 19:8205923-8205945 GCTCAGATGTCACCTCTTCCAGG + Intronic
1164874675 19:31675578-31675600 GGTCTAACATCACCTTTTCCAGG - Intergenic
1165324862 19:35108717-35108739 GCTCAAATATCACCTTCTCAAGG - Intergenic
1165378389 19:35460173-35460195 GCTCAAATATCACCTTTGCATGG - Intergenic
1165731032 19:38144858-38144880 GTTCAGATGTCACCTCCTCCAGG - Intronic
1165984737 19:39758148-39758170 GCTCAAATATCTCCTTCTCCAGG - Intergenic
1166991059 19:46693095-46693117 GTTCAGATGTCACCTCCTCCAGG + Intronic
1168073539 19:53965844-53965866 GATCAAATGTCACCTGCTCGGGG - Intronic
925300531 2:2808480-2808502 GTTCATATTTCACCTCCTCCAGG + Intergenic
926781426 2:16475957-16475979 GTCCAAATTTCTCTTGTTCCTGG - Intergenic
926916344 2:17895741-17895763 GTCCAAATGTCGCCTCTTCCAGG - Intronic
927290270 2:21398094-21398116 GTTCCAATATCAGCTCCTCCAGG - Intergenic
927672182 2:25077973-25077995 GCTCACATCTCACCTCTTCCAGG + Intronic
927776178 2:25905283-25905305 GTTCAAGTATCACCTCCTCCAGG + Intergenic
930695911 2:54411559-54411581 GTTTAGATATCACTTTTTCCAGG - Intergenic
932032690 2:68206610-68206632 TTTCAAATGTCACCCCTTCCAGG + Intronic
933606584 2:84390077-84390099 GTTGTAATATCACCTGGTCTTGG + Intergenic
933648773 2:84832446-84832468 GCTCACATATCACCTCTTCTGGG - Intronic
935207984 2:100913236-100913258 GTTCAAATACCAGCTCTTCTTGG + Intronic
936272145 2:111057121-111057143 GCTCAAATATCACCTCCTCAGGG - Intronic
937161306 2:119764510-119764532 TTTCAAAATTCACCTGTTTCTGG + Intronic
937472695 2:122187738-122187760 GTCCAAATATCACCTCTTGCAGG - Intergenic
937475310 2:122209771-122209793 CAACAAAGATCACCTGTTCCTGG + Intergenic
938208216 2:129441790-129441812 ATTCAAATCTCACCTCCTCCAGG - Intergenic
939897422 2:147808843-147808865 GCTCAAATGTTACCCGTTCCTGG + Intergenic
940427918 2:153552067-153552089 GCTCAAATGTCACATGTTTCTGG + Intergenic
940967889 2:159860507-159860529 GTTCAAGTCCCACCTCTTCCTGG + Intronic
942636544 2:178013091-178013113 GATCAAATACCGCCTCTTCCAGG + Intronic
943699998 2:190979395-190979417 GTTGAAATATCAGCCGATCCTGG + Intronic
944192508 2:197018463-197018485 GCTCAAATATCACCTTATCAGGG + Intronic
944903647 2:204241110-204241132 GCTCAAATATTACCTCTTCAGGG + Intergenic
945009173 2:205443562-205443584 GTTCAAATATCACCTCTGTTTGG - Intronic
945593239 2:211760618-211760640 TTTCAAATCTCACCTGTTACTGG + Intronic
945697258 2:213122830-213122852 GCAGAAATATCACGTGTTCCAGG - Intronic
946783657 2:223219881-223219903 GGTCATATATCATTTGTTCCAGG - Intergenic
947042302 2:225937045-225937067 GTTCAAATATCTCCTTTTCAGGG + Intergenic
947140828 2:227018136-227018158 GCTCAAATACCACCTCTTGCTGG + Intronic
947244065 2:228027471-228027493 TTTCAAATGTTACCTGTTGCAGG + Exonic
947550455 2:231041743-231041765 GATCAAATATCACTTGCTCTAGG - Intronic
948105734 2:235412242-235412264 GTTCTAATATCTTCTCTTCCAGG - Intergenic
1168907302 20:1416655-1416677 GTTAAAACATCACCTCCTCCAGG + Intergenic
1170783104 20:19444174-19444196 GAACAAATATCACCTGGTCATGG + Intronic
1172221539 20:33277545-33277567 GATCAAATGTCACCTCTTCCAGG + Intronic
1172397726 20:34621177-34621199 GTTCATTTATCACATGTGCCAGG - Intronic
1172621772 20:36322119-36322141 GTTCAAGTGTCACCTCCTCCAGG - Intronic
1172847343 20:37937851-37937873 CTTCAAATAGCACCTCCTCCAGG - Intronic
1173178897 20:40786690-40786712 GTTGAGACATCACCTTTTCCAGG + Intergenic
1174266007 20:49332746-49332768 GTTCAAATGTCACCTTCTCAGGG - Intergenic
1174360180 20:50023960-50023982 GCTCAAATATCACCTCCTCAGGG - Intergenic
1174398127 20:50260580-50260602 GCTCAAACATCCCCTCTTCCAGG + Intergenic
1175767902 20:61603725-61603747 GCTCAAATGTCACCTCTTCCAGG - Intronic
1175956222 20:62610796-62610818 GCTAAAATGTCACCTCTTCCAGG - Intergenic
1177268681 21:18817105-18817127 ATTTTAATATCACATGTTCCTGG - Intergenic
1178103751 21:29297656-29297678 ATGCAAATGTCACCTGCTCCAGG + Intronic
1179896868 21:44367975-44367997 GTTCAGGTCTCACCTGCTCCAGG + Intronic
1181349551 22:22245180-22245202 GCTCAAATACCCCCTGTTCCTGG - Exonic
1181910536 22:26234878-26234900 GCTTAAATATCACCTCTTCCAGG - Intronic
1182008668 22:26982306-26982328 TTTCAAATGTCATCTCTTCCAGG - Intergenic
1182052052 22:27320768-27320790 GTTCAAACATCACCTCCTCACGG - Intergenic
1182373434 22:29828584-29828606 GTTCCAATCTCACCTCTTCCAGG + Intronic
1182910779 22:33982244-33982266 GGTCCAATATTACTTGTTCCAGG + Intergenic
1182951668 22:34381864-34381886 GTACAAACAACACCTGTGCCAGG + Intergenic
1183086181 22:35488696-35488718 GTTCAAATATCACCTCTGCTGGG - Intergenic
1183245913 22:36693208-36693230 ATTCAAATATCACCTTCTCAAGG - Intronic
1183378028 22:37476426-37476448 GCTCAAATACCACCTCTTCCTGG + Intronic
1184431745 22:44445116-44445138 GCTCAAACATCACCTCCTCCAGG - Intergenic
1184673890 22:46029843-46029865 GTTCAGATACCACCTCCTCCAGG + Intergenic
950365832 3:12483490-12483512 GCTCAAATATCACCTCTTCCAGG - Intergenic
950451653 3:13068788-13068810 GTTCAAAGGTCACCTCCTCCAGG + Intronic
950634745 3:14306979-14307001 GTTCTTGTATCACCAGTTCCAGG - Intergenic
950794548 3:15500114-15500136 GCTCAAATCCCACCTCTTCCAGG - Intronic
950850357 3:16056468-16056490 TTTCAGATGTCACCTCTTCCAGG + Intergenic
953004383 3:38964571-38964593 GTTTAAATCTCACCTCTTCTCGG - Intergenic
953229831 3:41054921-41054943 GTTCCAGTATCACCTCCTCCAGG - Intergenic
954133746 3:48572658-48572680 GGTCAAAGATCACCTGTCCAGGG + Exonic
956682122 3:71790594-71790616 GTTCAAATCTCACCTTTGCAAGG + Intergenic
957054492 3:75433573-75433595 GTTCAAATACCACCTCTTTGGGG + Intergenic
957168919 3:76711828-76711850 GTTTAAATGTCACTTCTTCCTGG + Intronic
957845918 3:85735246-85735268 GTTCAAATGTCCACTTTTCCTGG - Intronic
959343553 3:105162635-105162657 TGTCAAGTTTCACCTGTTCCAGG + Intergenic
960728454 3:120696470-120696492 GTTCAAATATAACATGTTTTTGG - Intronic
961055090 3:123780984-123781006 TTCCAAATGTCACCTCTTCCAGG - Intronic
963261196 3:143192804-143192826 GTTCAAATGTCACCTCCTCCCGG + Intergenic
964634508 3:158844723-158844745 GCTCAAATCCCACCTGTGCCAGG + Intergenic
966501727 3:180649857-180649879 GTACTAATATCATCTGTTACAGG + Intronic
966775930 3:183542538-183542560 GTTCAGATATCACCTCTGCCAGG + Intronic
967823787 3:193862485-193862507 GTGCAAATACCACCTTTTCTGGG + Intergenic
969096552 4:4736816-4736838 GTTCCAGCATCACCTCTTCCTGG - Intergenic
969273209 4:6116862-6116884 TATCAAATATCACCTGTCACGGG + Intronic
969628231 4:8319329-8319351 GCTCAAATGTCACCTCCTCCAGG - Intergenic
969858256 4:10017091-10017113 GCTCAAATACCACCTCCTCCAGG + Intronic
969975972 4:11101772-11101794 TTTCAGATATTACCTCTTCCGGG + Intergenic
970179500 4:13375228-13375250 GATAAAATTTCACCTGATCCAGG + Intronic
971166515 4:24189537-24189559 TTTCTAATGTCACCTCTTCCAGG + Intergenic
971262607 4:25070687-25070709 AGTCAAATATCACCTCCTCCGGG + Intergenic
973082337 4:46009941-46009963 GTTCAAATATCACTTTATCAAGG - Intergenic
973253344 4:48083920-48083942 GTTTAAATATTACCTCTTTCAGG - Intronic
975605356 4:76148826-76148848 GTTCAAATACCACCTCCTCGTGG - Intergenic
976561347 4:86505102-86505124 GTTCAACCTTCACCTGTTTCTGG + Intronic
977163478 4:93665913-93665935 GTTCTAATATTACGTCTTCCTGG + Intronic
977437938 4:97023872-97023894 GTTAAGATGTCACCTCTTCCAGG + Intergenic
978189224 4:105894346-105894368 GCTCAAATGTCACCTCTTCCAGG - Intronic
978359137 4:107909591-107909613 GCTCAAATGCCACCTCTTCCAGG + Intronic
978867090 4:113526138-113526160 GTTCTAATATCACATGTTGAGGG - Intronic
978959672 4:114661198-114661220 GGTCAAATATCTTCTGCTCCTGG - Intronic
982080170 4:151781904-151781926 ATTCTAATATCACTTATTCCTGG + Intergenic
982444595 4:155475177-155475199 GTTCAAGTATAACCTGGTCCAGG + Intergenic
984276380 4:177616111-177616133 ATTGAACTATCACCTTTTCCGGG + Intergenic
984409636 4:179379863-179379885 TTTCAAATATCACCTGTATATGG + Intergenic
986778180 5:11038640-11038662 ATTCAAAGTTCACCTCTTCCAGG - Intronic
987811507 5:22842061-22842083 TTTCAAATATAACCTGTTTGAGG - Intronic
990357728 5:54986667-54986689 CTTAAAATATCAACTGTGCCAGG + Intronic
990911786 5:60860007-60860029 ACTCAAATTTCACCTTTTCCAGG - Intergenic
992538432 5:77736713-77736735 GCTCAAATACCATCTCTTCCTGG + Intronic
992624618 5:78625961-78625983 GTTAAAATAGCATCTGTTCAGGG - Intronic
993914765 5:93730740-93730762 GTTCACATATCAACTTTTCTGGG + Intronic
995500735 5:112804137-112804159 GTTTAAATGTCACTTCTTCCTGG + Intronic
995835120 5:116392918-116392940 GATCAAATATCACTTCTTCCAGG + Intronic
998007758 5:138668385-138668407 GTTCAAATCTCACCTGGTCCTGG + Intronic
998206997 5:140165103-140165125 GCTCAAATGTCACCTTTTCAAGG - Intergenic
998389105 5:141775633-141775655 GTTTAAATGTCACCTACTCCAGG + Intergenic
999251522 5:150185191-150185213 GTTCAAACATTACCTACTCCAGG - Intergenic
999672119 5:153966956-153966978 GCTCAATTCTCACCTGCTCCAGG + Intergenic
1001154467 5:169261213-169261235 ATTAAAATGTCACCTGTTCCTGG - Intronic
1001169474 5:169405098-169405120 GTTCAAATGCCATCTCTTCCAGG - Intergenic
1001305775 5:170571475-170571497 GTTGAAACATCACTTCTTCCTGG + Intronic
1001749240 5:174116220-174116242 GTTCAAGCATCACTTTTTCCAGG + Intronic
1002095101 5:176825973-176825995 GTTCAAGTGTCACCTCTTCCAGG - Intronic
1003672519 6:8172700-8172722 GATCAAATATCACTTTCTCCTGG + Intergenic
1004309229 6:14529426-14529448 TTTGAAAGATCCCCTGTTCCTGG - Intergenic
1006284106 6:33080220-33080242 GTTCAAATGCCACCTCCTCCAGG - Intronic
1007226973 6:40321898-40321920 TTTCAAAGGTCACCTATTCCTGG - Intergenic
1008367114 6:50694452-50694474 ATTCAAATATTACCTCTTCAGGG + Intergenic
1008523005 6:52380220-52380242 GCTCAAATCTCACCTCTTCAAGG - Intronic
1008712118 6:54240174-54240196 TTTCATATATCACTTGATCCTGG - Intronic
1011355406 6:86468172-86468194 GCTCAAATATCACCTCCTCAGGG - Intergenic
1014620155 6:123657888-123657910 GCTCAAATATCACTACTTCCTGG - Intergenic
1015739669 6:136440363-136440385 GCTCAGATGTCACCTATTCCAGG - Intronic
1022580919 7:31553257-31553279 GTTCCAAAATCACCTGCCCCTGG - Intronic
1022735469 7:33071645-33071667 GTTCAATTATCTCCTGTTCAGGG - Intergenic
1023582924 7:41701018-41701040 CTTCAAATATCACCATTTTCGGG + Intronic
1023628530 7:42140134-42140156 TTTCAGATATCACCTCCTCCGGG + Intronic
1023892974 7:44406793-44406815 GTTGACATCTCATCTGTTCCTGG - Intronic
1026269462 7:68823646-68823668 GTTCCAATCTCTCCTCTTCCTGG - Intergenic
1026739726 7:72971306-72971328 GTTCAAATGCCCCCTCTTCCAGG - Intergenic
1027104007 7:75393764-75393786 GTTCAAATGCCCCCTCTTCCAGG + Intergenic
1029015102 7:97307939-97307961 GTTCAAAGATGACCTGAGCCAGG - Intergenic
1030356271 7:108546408-108546430 GTTCAAATATCACCTGTTCCAGG - Intronic
1031382887 7:121110465-121110487 GCTCAGATATCACCTATTCAGGG - Intronic
1031543473 7:123024412-123024434 GTTCAAATATCACCTTCACAAGG + Intergenic
1034204237 7:149301858-149301880 GTGTTAGTATCACCTGTTCCAGG + Intergenic
1035150094 7:156862861-156862883 ATTCAAACATCAGCTCTTCCGGG + Intronic
1036590762 8:10165950-10165972 GTTCAAATCCCAGCTATTCCAGG - Intronic
1039804704 8:40988019-40988041 GCTGAAAGATCACCTGGTCCAGG + Intergenic
1041217036 8:55611028-55611050 ACTCAAATATCCCCTCTTCCGGG - Intergenic
1042676760 8:71329951-71329973 GTTCAAATCTCACCTCATCGAGG - Intronic
1042865081 8:73349759-73349781 GTTCAGGTATCACCTCCTCCAGG - Intergenic
1043218425 8:77626153-77626175 GTTCAAATATAACTTCCTCCAGG + Intergenic
1043885974 8:85601096-85601118 CATGAAATATAACCTGTTCCAGG + Intergenic
1043995702 8:86812710-86812732 TGTCAAATATCTACTGTTCCAGG - Intergenic
1045588861 8:103570073-103570095 TGTCAAATATCACGTGTTCCAGG + Intronic
1046612066 8:116437152-116437174 GTTCAAATATCACCTCTACAGGG - Intergenic
1046648585 8:116812368-116812390 GCTCAAACATCATCTCTTCCAGG - Intronic
1046665996 8:117003640-117003662 GATCAAATATCATCCCTTCCAGG - Intronic
1046711227 8:117513983-117514005 TTTCAAATATCTCTTGATCCTGG + Intergenic
1047475839 8:125228521-125228543 GCTCAAATGTCAGCTCTTCCAGG - Intronic
1048004468 8:130408075-130408097 GTTGAAATTCCACCTCTTCCAGG + Intronic
1048066236 8:130971692-130971714 GCTCACATATCACCTCTTCCAGG - Intronic
1050278993 9:4031007-4031029 GTTCAAATTTCTCCACTTCCTGG - Intronic
1051042065 9:12824027-12824049 GATCAAATATCAAATGGTCCAGG - Intergenic
1051688247 9:19681294-19681316 GCTCAAATATCACCTTTCTCAGG + Intronic
1052153186 9:25146004-25146026 GTTCAAATCTCAATTGTTCATGG - Intergenic
1053100332 9:35366265-35366287 GTTCAAAAATCACCTTTTAAAGG - Intronic
1053286966 9:36855888-36855910 GCTCAAATACCACCTCCTCCAGG + Intronic
1054732098 9:68711909-68711931 GCTTAAATATCACCTCCTCCTGG + Intronic
1054779804 9:69155856-69155878 TTTCAAATATCACCTGCCGCAGG - Intronic
1056119621 9:83474517-83474539 GTTTAAATGACACCTGTTTCTGG + Intronic
1056260267 9:84841607-84841629 GTTCAAATATCACTGTCTCCCGG + Intronic
1056836599 9:89960752-89960774 GTTCAAATACAACCAGTTACTGG + Intergenic
1057955721 9:99406158-99406180 GCTCAAATATCACCTCTTACAGG + Intergenic
1058602629 9:106686886-106686908 CCTCAAATATCACCTTTACCAGG - Intergenic
1058866054 9:109163393-109163415 GCTCAAATGTCACCTCTTTCAGG - Intronic
1059104376 9:111499119-111499141 CTTCAAATACCACATGTACCAGG - Intergenic
1059454850 9:114393599-114393621 TTTCAATGATCACCTGTTACGGG - Intronic
1059963796 9:119593547-119593569 ATTCATATATCACTTCTTCCAGG - Intergenic
1060006120 9:120001378-120001400 TTGCAAATATCACCTCCTCCAGG + Intergenic
1061750518 9:132773831-132773853 GCTCAAATGCCACCTGCTCCAGG - Intronic
1062658732 9:137617609-137617631 GTTGAAATATCACCTCTTAAGGG - Intronic
1188861595 X:35263482-35263504 GATCAAATATTACCTCTTTCTGG - Intergenic
1189319170 X:40077116-40077138 ATACAAATGTCAGCTGTTCCAGG + Intronic
1190759716 X:53429374-53429396 TTTCAAGGATCACCTCTTCCTGG + Intronic
1191730946 X:64334806-64334828 GTTAAAATGTCACCTATTACAGG + Intronic
1192189076 X:68979739-68979761 GTTTAGATATCACCTCTTCCAGG - Intergenic
1193517182 X:82480373-82480395 GTTCAAATATCACTTCGTCAGGG + Intergenic
1194463712 X:94205524-94205546 GCTCAAATATCACCTCTTCTTGG + Intergenic
1194819192 X:98485327-98485349 GATCAAATATCACTTTTTCAAGG - Intergenic
1195459597 X:105109067-105109089 GTTCAAATATCACTTCCACCAGG + Intronic
1196647034 X:118128940-118128962 GTTCAAATACCAGCAGTACCAGG + Intergenic
1197866647 X:131026131-131026153 TTTCAAATATCACTTCTTCCAGG - Intergenic
1198061393 X:133048500-133048522 TTTAAAATAGCACCTGCTCCAGG - Intronic
1198320068 X:135511633-135511655 GTTCAGATACCACCTCCTCCAGG + Intergenic
1200334244 X:155332377-155332399 CCTCAAATATCATCTGGTCCAGG - Intronic