ID: 1030356273

View in Genome Browser
Species Human (GRCh38)
Location 7:108546430-108546452
Sequence CTGGTTCTTCAGTGATACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030356271_1030356273 -1 Left 1030356271 7:108546408-108546430 CCTGGAACAGGTGATATTTGAAC 0: 1
1: 0
2: 6
3: 49
4: 322
Right 1030356273 7:108546430-108546452 CTGGTTCTTCAGTGATACATAGG No data
1030356269_1030356273 15 Left 1030356269 7:108546392-108546414 CCAGTTGGTGTGTACACCTGGAA 0: 1
1: 0
2: 1
3: 8
4: 79
Right 1030356273 7:108546430-108546452 CTGGTTCTTCAGTGATACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030356273 Original CRISPR CTGGTTCTTCAGTGATACAT AGG Intronic
No off target data available for this crispr