ID: 1030358598

View in Genome Browser
Species Human (GRCh38)
Location 7:108570206-108570228
Sequence CATGCAGCCCATTGTCCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 177}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030358598_1030358601 4 Left 1030358598 7:108570206-108570228 CCGCAGGGACAATGGGCTGCATG 0: 1
1: 0
2: 0
3: 13
4: 177
Right 1030358601 7:108570233-108570255 TGGCCGAGAGAATGGAAGAACGG 0: 1
1: 0
2: 0
3: 24
4: 387
1030358598_1030358600 -4 Left 1030358598 7:108570206-108570228 CCGCAGGGACAATGGGCTGCATG 0: 1
1: 0
2: 0
3: 13
4: 177
Right 1030358600 7:108570225-108570247 CATGTTTTTGGCCGAGAGAATGG 0: 1
1: 0
2: 2
3: 7
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030358598 Original CRISPR CATGCAGCCCATTGTCCCTG CGG (reversed) Intronic
900543510 1:3215870-3215892 CATACATCCCATTGTTCCCGGGG + Intronic
901230070 1:7636875-7636897 GCTGCAGGGCATTGTCCCTGAGG + Intronic
906791625 1:48663318-48663340 CATCCAGCCCATTCCCTCTGGGG - Intronic
907464032 1:54623427-54623449 CGTGCGGCCCAGAGTCCCTGAGG + Exonic
907755098 1:57303404-57303426 CAGGCAGCAGATTGTCCTTGGGG - Intronic
908120825 1:60984438-60984460 CATGCAGAACATGGTCCCAGAGG + Intronic
909685585 1:78344693-78344715 AATTTAGACCATTGTCCCTGAGG + Intronic
910392604 1:86760317-86760339 CATCCAACACAATGTCCCTGAGG + Intergenic
912390986 1:109302683-109302705 AATTCAGCCAATGGTCCCTGTGG + Intronic
916842531 1:168614870-168614892 CATGGAGCCCAGTGACACTGTGG + Intergenic
917522274 1:175757991-175758013 CATGGAGCCCGCTGTCCCTGAGG - Intergenic
918766059 1:188485221-188485243 CTCCCAGCCCATTGTCACTGAGG + Intergenic
920033702 1:203052097-203052119 CAGGCAGCCAACAGTCCCTGAGG + Intronic
920200799 1:204258649-204258671 CCTGCAGCCCATTTGCCCTGAGG + Intronic
920864029 1:209736324-209736346 AATCCAGCCCTTTGTCCATGTGG - Intergenic
920980557 1:210830394-210830416 CTTGCAGGCCATTTCCCCTGAGG + Intronic
920982610 1:210852415-210852437 CATGCAGCCCATGTTGACTGAGG - Intronic
921181822 1:212637380-212637402 CATGTAGCTCATTCTCCCTGTGG - Intergenic
924917824 1:248592295-248592317 AATGAACCCCCTTGTCCCTGAGG + Intergenic
1065825493 10:29566865-29566887 CAGACACCCCTTTGTCCCTGGGG - Intronic
1066695700 10:38075886-38075908 CAAGCAGACCATGGTCCCTTAGG - Intergenic
1066996836 10:42571678-42571700 CAAGCAGACCATGGTCCCTTAGG + Intergenic
1075062934 10:119269392-119269414 CATGCAGCCGAGGGTTCCTGGGG + Intronic
1075482246 10:122791882-122791904 CATCCCACCCATTGCCCCTGTGG - Intergenic
1076128509 10:127994735-127994757 CATGCAGCCCGATGTCGCAGGGG + Intronic
1078416387 11:11169784-11169806 AGTGCAGCCCATAGTCCCAGGGG + Intergenic
1080749962 11:35142147-35142169 CATGCATCTCCTTGTCTCTGTGG + Intronic
1081112179 11:39149668-39149690 CATGAAGCCCAGTGACACTGTGG - Intergenic
1081759378 11:45566531-45566553 CATGCAGTGTATAGTCCCTGAGG - Intergenic
1081776675 11:45680477-45680499 CATGGAGGCCATTGTCCAAGGGG + Intergenic
1082705285 11:56487188-56487210 CATGCATCCCATGTTCCCTTTGG - Intergenic
1084319386 11:68365106-68365128 CCAGGAGCCCATTGTCTCTGGGG + Intronic
1084526174 11:69699390-69699412 CATGCTGCCCATGGTCCCAGAGG - Exonic
1085156586 11:74300982-74301004 CATTCAGCACATTGTATCTGTGG - Intronic
1087277173 11:96172211-96172233 ATTGCAGGCCATTCTCCCTGTGG + Intronic
1088986514 11:114914044-114914066 CATCCAGCACCTTGTTCCTGGGG + Intergenic
1092526663 12:9313864-9313886 CATGGAGACCTTTGTTCCTGTGG + Intergenic
1092540610 12:9417915-9417937 CATGGAGACCTTTGTTCCTGTGG - Intergenic
1092909615 12:13135462-13135484 AATGCAGCCAAGTGCCCCTGGGG + Intronic
1097618900 12:61916101-61916123 CATGAAGCCCTTTGTCACTGAGG + Intronic
1100080719 12:90846810-90846832 AATGCATCCCATTGTTTCTGAGG - Intergenic
1101267110 12:103100558-103100580 CATGCATGCCATTGTCCGGGTGG - Intergenic
1101526768 12:105538250-105538272 CATCCAGAACCTTGTCCCTGGGG - Intergenic
1103884850 12:124192613-124192635 CCTGCCGCCCATGGCCCCTGTGG - Intronic
1104897004 12:132169346-132169368 CACGCAGCCCACCCTCCCTGAGG - Intergenic
1110663549 13:78088182-78088204 AATGCAGTTCAGTGTCCCTGGGG + Intergenic
1113570225 13:111348525-111348547 CATGCATCCCATTAAGCCTGTGG - Intergenic
1113815220 13:113165046-113165068 AATGCAGACCAGTGTGCCTGCGG + Exonic
1114082762 14:19215890-19215912 CATGCAGCCTTCTGTCACTGTGG + Intergenic
1114689895 14:24571492-24571514 CATTCAGCCCTTCCTCCCTGTGG - Intergenic
1115772728 14:36683209-36683231 GAGGCAGCCGATTCTCCCTGTGG + Intronic
1119225742 14:72943483-72943505 CCTGCAGCCCAGTGTGCCTTTGG + Intronic
1119535870 14:75402046-75402068 CAGGCCTCCCTTTGTCCCTGGGG + Intergenic
1120730054 14:87992319-87992341 CATGAAGCCCATGGGCCCAGAGG + Intronic
1121467374 14:94124641-94124663 CATGCAGACCTTTTTCCCTGCGG - Intergenic
1121493672 14:94377789-94377811 CCTGAAGCCCATTCTCCATGGGG - Exonic
1122470182 14:101961079-101961101 CATGCACCCCACTGCCCATGGGG - Intergenic
1122496690 14:102161650-102161672 CCTGAAGCCCACTGTACCTGTGG - Intronic
1122985670 14:105210606-105210628 CATGAAGCCCAGGGTCTCTGTGG + Intronic
1124372795 15:29112979-29113001 CATGCAGCATAGTGTCCCCGAGG + Intronic
1125525678 15:40372721-40372743 CCTGTGGCTCATTGTCCCTGAGG - Intergenic
1126798240 15:52277732-52277754 CGTGCAGCTCCCTGTCCCTGGGG - Intronic
1127636033 15:60870682-60870704 GATGCAGGCCATTGTCCAGGAGG - Intronic
1128714043 15:69893956-69893978 CATGCAGCAAGTTCTCCCTGGGG + Intergenic
1130118620 15:81027373-81027395 CATGCATTCCATTGTTTCTGAGG - Intronic
1131386446 15:92012111-92012133 CAAGCAACCCACTGTCACTGAGG + Intronic
1137577850 16:49615449-49615471 TTTTCAGCCCACTGTCCCTGGGG - Intronic
1139714509 16:68802110-68802132 CATGTTGCCCATGGCCCCTGGGG + Intronic
1140191076 16:72817608-72817630 GATGCAGACCATTCTCCCTCTGG + Intronic
1141501282 16:84445814-84445836 CATGCATCCCACTGTCCCACAGG - Intronic
1141549229 16:84794159-84794181 CATGCAGACCAATGTCCATCAGG - Intergenic
1142808337 17:2383408-2383430 CTGGAAGCCCCTTGTCCCTGTGG - Intergenic
1142893276 17:2958821-2958843 CAAGCAGCCAGGTGTCCCTGAGG + Intronic
1145998780 17:29119158-29119180 CATCCATCTCACTGTCCCTGGGG + Intronic
1146628029 17:34448731-34448753 CATGTACCCCATTGCCTCTGGGG - Intergenic
1147253240 17:39165952-39165974 CAGGCAGCCCTTAGTCACTGGGG - Intronic
1147948872 17:44095938-44095960 CACTCGGCCCATTGTCCATGTGG - Intronic
1150221217 17:63496918-63496940 CATGCAGCTCGTTCTCCGTGCGG - Exonic
1150436872 17:65160719-65160741 CACCCAGCCCCTTGCCCCTGGGG - Intronic
1151553430 17:74834960-74834982 AACACAGCCCCTTGTCCCTGCGG + Intronic
1151657091 17:75501210-75501232 CCTGCACCCCACTGGCCCTGGGG + Intronic
1152137339 17:78512232-78512254 CATGCTGCCCTTGGTCCTTGGGG + Intronic
1152506474 17:80752334-80752356 CATGCAGCCCACAGTGTCTGAGG + Intronic
1156267462 18:35501540-35501562 AATGAAGCCCATTGTCCACGAGG + Intergenic
1156747236 18:40407082-40407104 CTTCCATCCCATTCTCCCTGTGG - Intergenic
1159022695 18:63156211-63156233 GTGGCAGCCCATTGTCCCTCAGG + Intronic
1160250792 18:77202064-77202086 CCTGGAGCTGATTGTCCCTGAGG + Intergenic
1160507396 18:79434760-79434782 CAAACAGCCATTTGTCCCTGCGG - Intronic
1161404099 19:4082099-4082121 CAGGGAGCCCAGTGTCCGTGGGG + Intergenic
1161430828 19:4231345-4231367 CAGGAAGTCCAGTGTCCCTGAGG - Intronic
1163462466 19:17447461-17447483 CATGCATTTCATTGTCCCTTGGG + Intronic
1163635186 19:18434129-18434151 CCTGTCCCCCATTGTCCCTGGGG + Intronic
1166850609 19:45758875-45758897 CAGGGAGCCCACTGTTCCTGGGG + Exonic
1168273961 19:55265966-55265988 CATGGAGCACAGGGTCCCTGGGG + Exonic
925754393 2:7119776-7119798 CATCCACCACATTATCCCTGTGG - Intergenic
929568764 2:43006699-43006721 CCTGCAGCCCATACTCCTTGAGG - Intergenic
934612444 2:95751330-95751352 GATGCAGCTCATGGTCCCAGTGG + Intergenic
934771166 2:96908357-96908379 CATGCAGAGCATTCTCCCTTGGG - Intronic
934841708 2:97628114-97628136 GATGCAGCTCATGGTCCCAGTGG - Intergenic
936285221 2:111176358-111176380 CCTTCAGAGCATTGTCCCTGGGG - Intergenic
936740969 2:115508211-115508233 CATGCAATCCATTGTCTCTTGGG + Intronic
941915353 2:170809313-170809335 CAAGGAGGCCATTGTCCCTAGGG + Intergenic
942752800 2:179306949-179306971 CTTGGAGCCCATTGTAGCTGGGG + Intergenic
946249342 2:218403179-218403201 CATGCAGCCCAATGAACCTGCGG + Intronic
947380386 2:229539894-229539916 CATCCAGCACCCTGTCCCTGCGG + Intronic
948216924 2:236239061-236239083 CATGCAGGTCCATGTCCCTGGGG - Intronic
948998584 2:241597811-241597833 CATGCAGCCCCTGCACCCTGGGG - Intronic
1169343420 20:4812812-4812834 CATGCAGCCCAGTGCTCCTGTGG + Intronic
1173337476 20:42124535-42124557 CATTCAGCTCATTGTCCCAATGG + Intronic
1175161986 20:57015347-57015369 CATACAGCCCATGATCTCTGTGG + Intergenic
1177484976 21:21745724-21745746 CATGGAGAACATTTTCCCTGTGG - Intergenic
1179597478 21:42452489-42452511 CATGCTGCCAAATGTCCCTGGGG + Intergenic
1179603241 21:42495401-42495423 CATGCAGACCATAGTGGCTGAGG + Intronic
1179902573 21:44401675-44401697 CCTGCAGCCTCTTCTCCCTGCGG - Exonic
1180498017 22:15906779-15906801 CATGCAGCCTTCTGTCACTGTGG - Intergenic
1181061424 22:20283846-20283868 CAGGGAGCCAATTATCCCTGAGG + Intergenic
1181178864 22:21053497-21053519 CATGGAGCCCATGATTCCTGGGG - Intronic
1182296197 22:29312203-29312225 CAGGCAGCCCATTGGCCGTCCGG - Exonic
1182497182 22:30717829-30717851 CACACAACCCATTGTCACTGAGG - Intronic
1182869494 22:33633619-33633641 CCTTCAGCCCATTCTGCCTGGGG + Intronic
1184326703 22:43793253-43793275 CATCCAGACCATTCTCCCTCTGG - Intronic
950421472 3:12902061-12902083 TAGGCAGCCCATTCTCCCAGAGG - Intronic
950547419 3:13646607-13646629 CACCCACACCATTGTCCCTGGGG + Intergenic
953308548 3:41853863-41853885 CATGCAGCCCATGTTCACTTTGG - Intronic
953386213 3:42507382-42507404 CATGCGGCCCATTATCTCTCAGG + Intronic
953447975 3:42983698-42983720 AATGCAGCCCATGGAGCCTGTGG + Intronic
954720178 3:52554784-52554806 CATGCAGCCACTTCACCCTGGGG - Exonic
955539958 3:59964340-59964362 CACGCAGCCCATTGTTCATGGGG - Intronic
955727756 3:61950982-61951004 CTTTCAGCCCATTGGCTCTGTGG + Intronic
956147472 3:66205707-66205729 GAGGCAGCCCCTTGACCCTGTGG + Intronic
958026606 3:88058180-88058202 CTTGCACCCGATTTTCCCTGTGG + Intronic
960507736 3:118513780-118513802 CATGGATCCAATTGTCCTTGAGG + Intergenic
961942745 3:130655138-130655160 AATATAGCCCATTGTTCCTGAGG + Intronic
962512092 3:136112698-136112720 CATGCTGCCCATTGTGCTCGTGG + Intronic
963065504 3:141260683-141260705 CATGCAGCCCCTGCTGCCTGGGG - Intronic
966851330 3:184166833-184166855 CATCCGGCCCATTGACCCTGCGG + Exonic
968582642 4:1402187-1402209 CAGGCAGCCCCTTCTCCCCGGGG + Intergenic
973805316 4:54520029-54520051 CATGCAGGCCATCCTGCCTGCGG - Intergenic
974180530 4:58379294-58379316 CTTTCAGCCCATGCTCCCTGGGG + Intergenic
976573476 4:86639919-86639941 CATGCATCACAATGTCCTTGAGG - Intronic
978946239 4:114501276-114501298 AGTGAAGCCCATTATCCCTGAGG - Intergenic
979661378 4:123259483-123259505 CCTGCCACTCATTGTCCCTGTGG + Intronic
979745501 4:124207393-124207415 CATGCAGTTCAAAGTCCCTGGGG - Intergenic
981417639 4:144511640-144511662 CTTGTAGCCCATCTTCCCTGTGG - Intergenic
985764576 5:1770016-1770038 CAGGCAGCCCCCTGTCACTGCGG - Intergenic
986477567 5:8151407-8151429 CATTCACCCCATTTTCCCTTTGG + Intergenic
997781848 5:136667353-136667375 AGTGCAGGCCACTGTCCCTGGGG + Intergenic
998026315 5:138819530-138819552 GAAGCAGCACATTGCCCCTGGGG - Intronic
1004732004 6:18367433-18367455 CAGGCAGCCCATCATCACTGTGG + Intergenic
1005681954 6:28216927-28216949 CATGCAGCCTCTTCTCCCTGGGG - Intergenic
1006149914 6:31981565-31981587 CGTTCAGGCCATTCTCCCTGTGG + Intronic
1006156215 6:32014303-32014325 CGTTCAGGCCATTCTCCCTGTGG + Intergenic
1010144849 6:72656198-72656220 CATGCAGCCAAATTTCACTGGGG + Intronic
1014142285 6:117957502-117957524 CATACAGTCCATTGTTCCTTTGG + Intronic
1014367831 6:120566172-120566194 CATGCATACCATTGTCACTAGGG - Intergenic
1017597577 6:156045573-156045595 GATGCAGTGCATTGTCACTGGGG - Intergenic
1018420255 6:163634855-163634877 CATGCAGCCCTTTCTCCTTAGGG + Intergenic
1018505905 6:164468326-164468348 CATGAAGCCCATTTTACATGTGG - Intergenic
1019015135 6:168874446-168874468 CAGGCAGGCCTTTGTCCTTGAGG - Intergenic
1019115442 6:169757378-169757400 CATGCTTCACATTGGCCCTGTGG - Intronic
1019279077 7:191357-191379 CGTTGAGCCCATTGTTCCTGAGG - Intergenic
1019734795 7:2645314-2645336 TATGAAGCCCAGTTTCCCTGTGG + Intronic
1020016380 7:4834380-4834402 GCTGCAGCCCTTTGCCCCTGAGG - Intronic
1024132140 7:46363990-46364012 CATGCAGCTCATCATGCCTGGGG + Intergenic
1028384863 7:90243780-90243802 CATGCATCCCATGCTCACTGTGG + Intergenic
1029520543 7:101058621-101058643 CATGCAGTCCAGTGTCCAAGGGG - Exonic
1030201615 7:106911450-106911472 CATGCAGCCAGTTGGCCATGCGG + Intergenic
1030358598 7:108570206-108570228 CATGCAGCCCATTGTCCCTGCGG - Intronic
1032248700 7:130234413-130234435 CATGGAGGTCATTGTGCCTGGGG - Intergenic
1032400516 7:131620987-131621009 CATGCTGGCCTTTGTTCCTGGGG + Intergenic
1034493368 7:151406198-151406220 TCTGCAGCCCACTCTCCCTGGGG + Intronic
1036042463 8:5101189-5101211 CATCAAGCCCATTTGCCCTGAGG + Intergenic
1036637274 8:10559924-10559946 CATCCAGCCCATTGTCTTGGTGG + Intergenic
1037684314 8:21125384-21125406 GATGCACCCCCTTGCCCCTGGGG - Intergenic
1041762128 8:61378585-61378607 GAGGAAGCCCATGGTCCCTGGGG + Intronic
1043556785 8:81439408-81439430 CATGCAGCCCACAGTCCCAAAGG + Intergenic
1048440027 8:134452994-134453016 CATGTAGCCCACTCTCCCTGGGG - Intergenic
1048531149 8:135251599-135251621 CATGCAGCCTACAGTCCCAGAGG + Intergenic
1048787700 8:138068317-138068339 CATGCATGCTATTGCCCCTGAGG - Intergenic
1048976284 8:139674753-139674775 CAAGCACCCCAGTGACCCTGGGG + Intronic
1049104597 8:140603974-140603996 CATGCAGCTCCTTCACCCTGAGG - Intronic
1049587288 8:143437917-143437939 CAGGCAGAGCAGTGTCCCTGTGG + Exonic
1049603530 8:143518906-143518928 CAGGCAGCCCATTGCCTTTGAGG + Intronic
1049778864 8:144418381-144418403 CAGCCAGCCCATTGGTCCTGGGG - Intergenic
1053168814 9:35863784-35863806 CACACAGCCCACTGGCCCTGCGG + Intergenic
1056396573 9:86186825-86186847 CATGCAGCCCACAGTCCTAGAGG - Intergenic
1059882043 9:118702009-118702031 AGAGCAGCCCAATGTCCCTGGGG - Intergenic
1186999800 X:15164759-15164781 CATGCATCCCAGTTTACCTGTGG + Intergenic
1192560953 X:72127572-72127594 CCTGCTGCCCCATGTCCCTGTGG - Intronic
1193997582 X:88385021-88385043 CTTTCAGCCCATGCTCCCTGGGG - Intergenic
1199622565 X:149713408-149713430 CAGGCAACCAATTATCCCTGAGG + Intronic