ID: 1030359090

View in Genome Browser
Species Human (GRCh38)
Location 7:108576539-108576561
Sequence CAGAATAGACAGAGGGGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030359086_1030359090 -9 Left 1030359086 7:108576525-108576547 CCACGTGCTTTGTTCAGAATAGA No data
Right 1030359090 7:108576539-108576561 CAGAATAGACAGAGGGGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030359090 Original CRISPR CAGAATAGACAGAGGGGCAA TGG Intergenic
No off target data available for this crispr