ID: 1030365271

View in Genome Browser
Species Human (GRCh38)
Location 7:108638767-108638789
Sequence CTGACTCCTCAGAGAGTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030365271_1030365273 22 Left 1030365271 7:108638767-108638789 CCTTAGACTCTCTGAGGAGTCAG No data
Right 1030365273 7:108638812-108638834 TGAAGAATAGCATCTAAATCAGG No data
1030365271_1030365272 -3 Left 1030365271 7:108638767-108638789 CCTTAGACTCTCTGAGGAGTCAG No data
Right 1030365272 7:108638787-108638809 CAGAGAAGATATATTCTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030365271 Original CRISPR CTGACTCCTCAGAGAGTCTA AGG (reversed) Intergenic
No off target data available for this crispr