ID: 1030368750

View in Genome Browser
Species Human (GRCh38)
Location 7:108673998-108674020
Sequence AGTTTTCTGCAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030368750_1030368755 16 Left 1030368750 7:108673998-108674020 CCTGCCATCTTCTGCAGAAAACT No data
Right 1030368755 7:108674037-108674059 ACAGATCTTGGCCTGTTACTGGG No data
1030368750_1030368757 25 Left 1030368750 7:108673998-108674020 CCTGCCATCTTCTGCAGAAAACT No data
Right 1030368757 7:108674046-108674068 GGCCTGTTACTGGGCTTTGGTGG 0: 144
1: 161
2: 86
3: 68
4: 218
1030368750_1030368752 4 Left 1030368750 7:108673998-108674020 CCTGCCATCTTCTGCAGAAAACT No data
Right 1030368752 7:108674025-108674047 TCCTTTTGAGAGACAGATCTTGG No data
1030368750_1030368756 22 Left 1030368750 7:108673998-108674020 CCTGCCATCTTCTGCAGAAAACT No data
Right 1030368756 7:108674043-108674065 CTTGGCCTGTTACTGGGCTTTGG 0: 169
1: 171
2: 103
3: 76
4: 232
1030368750_1030368754 15 Left 1030368750 7:108673998-108674020 CCTGCCATCTTCTGCAGAAAACT No data
Right 1030368754 7:108674036-108674058 GACAGATCTTGGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030368750 Original CRISPR AGTTTTCTGCAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr