ID: 1030368752

View in Genome Browser
Species Human (GRCh38)
Location 7:108674025-108674047
Sequence TCCTTTTGAGAGACAGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030368750_1030368752 4 Left 1030368750 7:108673998-108674020 CCTGCCATCTTCTGCAGAAAACT No data
Right 1030368752 7:108674025-108674047 TCCTTTTGAGAGACAGATCTTGG No data
1030368751_1030368752 0 Left 1030368751 7:108674002-108674024 CCATCTTCTGCAGAAAACTACTC No data
Right 1030368752 7:108674025-108674047 TCCTTTTGAGAGACAGATCTTGG No data
1030368749_1030368752 25 Left 1030368749 7:108673977-108673999 CCTTGTATTTTAAAGCAAGGTCC No data
Right 1030368752 7:108674025-108674047 TCCTTTTGAGAGACAGATCTTGG No data
1030368748_1030368752 26 Left 1030368748 7:108673976-108673998 CCCTTGTATTTTAAAGCAAGGTC No data
Right 1030368752 7:108674025-108674047 TCCTTTTGAGAGACAGATCTTGG No data
1030368747_1030368752 27 Left 1030368747 7:108673975-108673997 CCCCTTGTATTTTAAAGCAAGGT No data
Right 1030368752 7:108674025-108674047 TCCTTTTGAGAGACAGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030368752 Original CRISPR TCCTTTTGAGAGACAGATCT TGG Intergenic
No off target data available for this crispr